Open Access

Whole-genome sequencing of clarithromycin resistant Helicobacter pylori characterizes unidentified variants of multidrug resistant efflux pump genes

  • Akira Iwamoto1,
  • Toshihito Tanahashi1, 2, 5Email author,
  • Rina Okada1,
  • Yukio Yoshida3,
  • Kaoru Kikuchi3,
  • Yoshihide Keida3,
  • Yoshiki Murakami4,
  • Lin Yang1,
  • Koji Yamamoto1,
  • Shin Nishiumi1,
  • Masaru Yoshida1 and
  • Takeshi Azuma1
Gut Pathogens20146:27

DOI: 10.1186/1757-4749-6-27

Received: 15 May 2014

Accepted: 18 June 2014

Published: 26 June 2014

Abstract

Background

Clarithromycin (CLR) is the key drug in eradication therapy of Helicobacter pylori (H. pylori) infection, and widespread use of CLR has led to an increase in primary CLR-resistant H. pylori. The known mechanism of CLR resistance has been established in A2146G and A2147G mutations in the 23S rRNA gene, but evidence of the involvement of other genetic mechanisms is lacking. Using the MiSeq platform, whole-genome sequencing of the 19 clinical strains and the reference strain ATCC26695 was performed to identify single nucleotide variants (SNVs) of multi-drug resistant efflux pump genes in the CLR-resistant phenotype.

Results

Based on sequencing data of ATCC26695, over one million sequencing reads with over 50-fold coverage were sufficient to detect SNVs, but not indels in the bacterial genome. Sequencing reads of the clinical isolates ranged from 1.82 to 10.8 million, and average coverage ranged from 90.9- to 686.3-fold, which were acceptable criteria for detecting SNVs. Utilizing the conventional approach of allele-specific PCR, point mutations in the 23S rRNA gene were detected in 12 clinical resistant isolates, but not in 7 clinical susceptible isolates. All sequencing reads of CLR-resistant strains had a G mutation in an identical position of the 23S rRNA gene. In addition, genetic variants of four gene clusters (hp0605-hp0607, hp0971-hp0969, hp1327-hp1329, and hp1489-hp1487) of TolC homologues, which have been implicated in multi-drug resistance, were examined. Specific SNVs were dominantly found in resistant strains.

Conclusions

Gene clusters of TolC homologues are involved in CLR susceptibility profiles in individual H. pylori strains. Whole-genome sequencing has yielded novel understanding of genotype-phenotype relationships.

Keywords

Whole-genome sequencing Helicobacter pylori Clarithromycin Multidrug efflux TolC homolog

Background

Helicobacter pylori (H. pylori) infection is recognized in approximately 50% of the adult population and associated with a wide range of upper gastrointestinal diseases [1, 2]. Present treatments for H. pylori infection consist of a proton pump inhibitor based triple therapy in combination with amoxicillin and clarithromycin (CLR) [2]. Triple therapy has remained the first-choice regimen for the past decade and has been recommended by most consensus meetings, and by both European and American scientific societies [36].

In many cases, CLR is the key component of eradication therapy, but antibiotic resistance is the primary failure of triple therapy in patients with H. pylori infection. Prevalence of CLR-resistant H. pylori has become increasingly common in many countries [7, 8]. Consequently, it has been suggested that the efficacy of standard triple therapy has been gradually reduced to unacceptable levels [9]. It is accepted that triple therapy should not be used to manage H. pylori infection when the prevalence of CLR resistance is higher than 15–20% [3]; in such cases, other therapeutic alternatives should be considered.

CLR binds to the peptidyl transferase region of the bacterial 23S rRNA and inhibits protein synthesis [10]. Acquired resistance of CLR in H. pylori has been associated with point mutations in the peptidyl transferase region of domain V of the 23S rRNA. Two copies of the 23S rRNA gene are present in H. pylori, and the most common mutation is an A-to-G transition at position 2146 and 2147 (previously known as A2142G and A2143G) [11]. Recent reports have also indicated that other 23S rRNA gene mutations might be associated with CLR resistance [12, 13]. In addition, CLR resistance seems to be related with other factors, such as rRNA methylase production [14], the actions of macrolide-inactivating enzymes, and active efflux pumps, which have been described in several bacterial species [15]. Indeed, an active efflux pump has been shown to contribute to CLR resistance in H. pylori[16]. As a result of the worldwide increased rate of CLR resistance, some studies have indicated that other bacterial genetic factors might contribute to this increased resistance [17, 18]. However, there is no genetic evidence for other bacterial factors in H. pylori.

To characterize the bacterial pathogen samples, recent advances in whole-genome sequencing, such as the development of DNA-sequencing technologies, were applied to this study [19]. Compared to conventional methods (e.g., capillary sequencing and non-sequence-based molecular methods), next-generation sequencing provides deep views on bacterial genome information without biases in downstream analysis [20]. These techniques are the ideal tool to comprehensively track extensive genomic knowledge of antimicrobial resistance and to facilitate specific and rational treatment of infected patients [21]. However, despite the broad advantages, next-generation sequencing requires the extensive bioinformatics tasks for data analysis from assembly to gene annotation, and this remains a significant problem for the routine application to clinical microbiology [22].

In this study, we first applied the established method of allele-specific PCR to detect 23S rRNA gene mutations in clinical H. pylori strains and identified CLR-resistant isolates. To elucidate the unidentified genetic factors in the reduced susceptibility to CLR in H. pylori, whole-genome sequencing was applied to 20 selected H. pylori strains, including the major laboratory strain ATCC26695, 12 resistant and 7 susceptible strains. Of note, we focused on variants of multidrug resistance (MDR) efflux pumps that contribute to both intrinsic and acquired antibiotic resistance and assessed their association with novel mechanisms of CLR resistance.

Results

AS-PCR for A2146G and A2147G mutations in 23S rRNA

For 19 clinical isolates, AS-PCR clearly differentiated the 23S rRNA mutants from the H. pylori (Figure 1). Point mutations in the 23S rRNA gene at position 2146 or 2147 were detected in 12 strains and defined as CLR-resistant isolates in this study. Twelve mutant strains were isolated from patients who failed eradication therapy, and 7 wild-type strains were isolated from patients with successful eradication therapy. Thus, AS-PCR results were in agreement with the outcome of eradication therapy based on clinical information (data not shown).
Figure 1

Representative electrophoresis patterns of allele-specific PCR products. PCR products were amplified with mixed primers for determination of A2146G and A2147G mutations in 23S rRNA of H. pylori. PCR products of 320 bp are commonly observed for the H. pylori 23S rRNA gene. PCR products of 238 or 240 bp indicate the presence of a point mutation in the 23S rRNA gene. PCR products were obtained from ATCC26695 (lane 1), J99 (lane 2), and five representative CLR-resistant strains (lanes 3–7; S1, S13, S17, S26, and 174). The 100 bp marker ladder is indicated by M.

ATCC26695 total reads and average coverage

Prior to analysis of clinical isolate sequencing data, we generated six independent sequencing data sets from ATCC26695 to determine the adequate total reads and average coverage that should be targeted for our study (Table 1). Illumina MiSeq generated 150-bp paired-end reads with 110,650 to 2,148,576 reads from the six samples. After trimming, the number of total reads was nearly unchanged before trimming. When all data were mapped to the theoretical nucleotide length of ATCC26695 (1,667,867 bp) using Genomics Workbench 6.0.1, the total consensus coverage (%) ranged from 87.38 to 99.99%, and average coverage was from 4.2- to 81.7-fold. In the sequencing data from sample 5 and 6, each with over one million reads, we found nearly equal total consensus coverage (99.98 and 99.99%, respectively) and average coverage (71.8- and 81.7-fold, respectively).
Table 1

Six ATCC26695 sequence data sets

Sample ID

Total reads (before trimming)

Total reads (after trimming)

Total consensus length (bp)

Total consensus coverage (%)

Average coverage (fold)

Assemble gaps (bp)

NCBI accession number

1

110,650

109,952

1,457,400

87.38

4.2

210,467

NA

2

130,226

130,216

1,649,483

98.89

5.9

18,384

NA

3

488,824

488,724

1,667,405

99.97

29.5

462

NA

4

664,278

642,532

1,667,519

99.97

36.3

348

NA

5

1,211,740

1,195,756

1,667,544

99.98

71.8

323

NA

6

2,148,576

2,107,718

1,667,758

99.99

81.7

211

DRS013117

Total reads after trimming are mapped to the reference nucleotides of 1,667,867 bp (NC_000915) and calculated with Genomic Workbench 6.0.1. NA; not available.

Quality control of ATCC26695 sequencing data

Adapter sequences were automatically trimmed from the reads with MiSeq reporter analysis. As shown in Table 1, the sequencing data from sample 6 of ATCC26695 was subjected to the quality control analysis.

As a measure of quality control, we determined the length distribution of sequencing reads, ambiguous base-content, and quality distribution at each base position (Additional file 1: Figure S1). This analysis led to the identification and subsequent removal of several errors in the raw sequencing data. After trimming, histograms of sequencing lengths distribution shifted to a shorter sequence length, and there was no ambiguous base-content. The mean values of Phred scores were >30 at all base positions up to 150 bp. Thus, quality control assessment showed that the entire length from the 150-bp paired-end reads could be analyzed. The FASTQ file, containing the trimmed sequences, was used for further analysis.

Coding sequence from ATCC26695 sequencing data

ATCC26695 sample 6 was chosen for further analysis based on its total number of reads, read quality, and coverage. Sequencing reads were aligned to the NC_000915 genome using Genomic Workbench 6.0.1. Analytical procedure was shown in Additional file 2: Figure S2 as a flow chart.

Despite over two million sequencing reads of ATCC26695, a total of 211 bp was identified as an assembly gap to the NC_000915 reference sequence (Table 2). The detailed assemble gaps were as follows; a total of 51 bp in 48 short insertions, 27 bp in 25 short deletions, and 133 bp in 4 long deletions. The quality and coverage of the sequence data was effective to determine the differences between isolates of a single laboratory strain. In our sequencing data, seven nucleotides per genome (1.66 Mb) were different from the reference nucleotides with over 50% frequency (Table 3).
Table 2

Assemble gaps of ATCC26695 sequence data from sample 6

Type

Length (bp)

Sequence

Nucleotide position in reference sequence

Locus tag

Locus_tag (5' ? 3')

Annotation

Coverage

  

Insertion

Deletion

Start

End

   

Insertion: consensus side/Deletion: reference side

Short insertion

1

1

A

 

39762

39763

HP0041

hypothetical protein

63

2

1

G

 

159581

159582

HP0147

cytochrome c oxidase, diheme subunit, membrane-bound (fixP)

89

3

1

C

 

173256

173257

HP0165

hypothetical protein

94

4

1

G

 

208167

208168

HP0203

hypothetical protein

85

5

1

C

 

263286

263287

HP0253

hypothetical protein

105

6

1

C

 

331675

331676

   

2

7

1

T

 

331678

331679

   

2

8

1

G

 

331680

331681

   

2

9

1

T

 

331682

331683

   

2

10

1

G

 

474218

474219

   

88

11

1

C

 

475466

475467

HP0456

hypothetical protein

53

12

1

C

 

475645

475646

   

46

13

1

T

 

524751

524752

HP0498

sodium- and chloride-dependent transporter

54

14

1

G

 

579891

579892

   

76

15

1

A

 

626216

626217

   

57

16

1

A

 

674290

674291

HP0628

hypothetical protein

63

17

1

C

 

683744

683745

HP0636

hypothetical protein

54

18

1

G

 

739962

739963

HP0688

hypothetical protein

45

19

1

T

 

745341

745342

HP0694

hypothetical protein

84

20

1

T

 

745352

745353

   

86

21

1

A

 

745389

745390

   

95

22

1

T

 

745429

745430

   

97

23

2

AG

 

773423

773424

HP0719

hypothetical protein

55

24

1

C

 

787709

787710

HP0732

hypothetical protein

62

25

1

G

 

808800

808801

fliD

flagellar capping protein

57

26

1

C

 

838354

838355

HP0783

hypothetical protein

74

27

1

A

 

843491

843492

   

69

28

1

G

 

861042

861043

HP0807

iron(III) dicitrate transport protein (fecA)

86

29

1

G

 

888773

888774

HP0836

hypothetical protein

98

30

2

AG

 

915893

915894

HP0863

hypothetical protein

112

31

1

A

 

915897

915898

HP0863

hypothetical protein

112

32

1

C

 

993909

993910

HP0931

hypothetical protein

109

33

1

G

 

1026924

1026925

   

63

34

1

T

 

1057531

1057532

   

69

35

1

T

 

1057599

1057600

   

59

36

1

T

 

1077873

1077874

HP1014

7-alpha-hydroxysteroid dehydrogenase

83

37

1

G

 

1207116

1207117

HP1144

hypothetical protein

74

38

1

C

 

1207608

1207609

HPr04

16S ribosomal RNA

101

39

1

G

 

1208482

1208483

HPr04

16S ribosomal RNA

1

40

1

C

 

1208483

1208484

HPr04

16S ribosomal RNA

2

41

1

T

 

1256328

1256329

HP1186

carbonic anhydrase

72

42

1

C

 

1259151

1259152

   

113

43

1

A

 

1264196

1264197

HP1193

aldo/keto reductase

92

44

1

G

 

1291618

1291619

HP1216

hypothetical protein

74

45

2

GG

 

1475694

1475695

HPr06

23S ribosomal RNA

1

46

1

C

 

1511030

1511031

   

4

47

1

C

 

1511162

1511163

HPr04

16S ribosomal RNA

83

48

1

C

 

1511398

1511399

HPr04

16S ribosomal RNA

11

Total

51

        

Short deletion

1

1

 

A

25622

    

58

2

1

 

C

38695

 

HP0039m

conjugal plasmid transfer system protein

62

3

2

 

YC

129158

129159

   

1

4

1

 

C

342188

 

HP0326

CMP-N-acetylneuraminic acid synthetase

86

5

1

 

T

426389

 

HP0413

transposase-like protein, PS3IS

18

6

1

 

A

463967

 

HP0445

hypothetical protein

75

7

1

 

A

593944

    

81

8

1

 

G

650897

 

HP0609

hypothetical protein

73

9

1

 

A

674221

 

HP0627

hypothetical protein

47

10

1

 

T

728119

 

HP0678

hypothetical protein

75

11

1

 

G

745422

    

98

12

1

 

C

815405

 

HP0760

phosphodiesterase

41

13

1

 

C

815420

 

HP0760

phosphodiesterase

48

14

1

 

R

1027030

    

73

15

1

 

G

1049706

    

58

16

1

 

G

1071033

 

HP1009

site-specific recombinase

77

17

1

 

T

1077870

 

HP1014

7-alpha-hydroxysteroid dehydrogenase

87

18

1

 

G

1081560

 

HP1018

hypothetical protein

97

19

1

 

G

1192591

 

HP1127

hypothetical protein

61

20

1

 

T

1256382

    

81

21

1

 

C

1258321

 

HP1188

hypothetical protein

71

22

1

 

T

1264200

 

HP1193

aldo/keto reductase

91

23

2

 

NA

1480608

1480609

HP1410

hypothetical protein

1

24

1

 

A

1480611

 

HP1410

hypothetical protein

1

25

1

 

A

1480614

 

HP1410

hypothetical protein

1

Total

27

        

Long deletion

1

42

 

TGATTATATTTGTAATGGTGCTCRCTTGTTTAAAATGAGYCT

129001

129042

HP0118

hypothetical protein

not calculated

2

61

 

KTCTTTTGGGTTTTGTAAAAATTACCTCCTTAATTTGGTTTTGTTTTGTTTAGACTTTAAC

425976

426036

HP0413

transposase-like protein, PS3IS

not calculated

3

14

 

GGATGGGTGCTTTT

1475703

1475716

HPrrnB23S

transposase-like protein, PS3IS

not calculated

4

16

 

NATCCGCGCTTAAGCG

1480568

1480583

HP1410

hypothetical protein

not calculated

Total

133

        
Table 3

SNVs of ATCC26695 sequence data from sample 6

 

Nucleotide position (NC_000915)

Reference nucleotide (NC_000915)

Mutated nucleotide

Total reads

Reads of mutated nucleotide

Frequency of mutated nucleotide (%)

Annotations

1

130106

T

C

217

117

53.9

Gene: HP0119

2

130111

T

G

186

94

50.5

Gene: HP0119

3

301322

G

T

109

108

99.0

Gene: HP0289

4

1370263

G

C

101

99

98.0

Gene: rpmJ

5

1428910

C

A

137

104

75.9

Gene: HP1366

6

1502547

T

C

345

184

53.3

 

7

1502549

A

G

345

184

53.3

 

Total reads and mutated reads indicate the number of reads that passed quality control.

Taken together, these sequencing data indicated that over one million sequencing reads had >50-fold average coverage of the assembled contigs when reads were mapped to the reference H. pylori genome. Since it was difficult to identify true single-base and small indels during our mapping process, we did not try to identify any size of indels in further analysis of the clinical isolates.

Whole-genome sequencing of 19 clinical H. pylori strains

All H. pylori strains were sequenced with illumina MiSeq. After triminng, total reads of 7 wild-type (susceptible) strains ranged from 1.96 million to 5.32 million (Table 4A). Similarly, total reads of 12 resistant strains ranged from 1.82 million to 10.8 million (Table 4B). After trimming above-mentioned, sequencing data were mapped to the ATCC26695 reference genome. Average coverage ranged from 90.9 to 283.6-fold in susceptibile strains and from 125.5 to 686.3-fold in resistant strains. These data indicated that the derived high sequencing depth of coverage was sufficient to detect high quality SNVs in the H. pylori genome.
Table 4

Whole-genome sequencing of 19 clinical H. pylori isolates

Strain

Total reads (before trimming)

Total reads (after trimming)

Total consensus length (bp)

Total consensus coverage (%)

Average coverage (fold)

NCBI accession number

CLR-susceptible

     

177

2,619,844

2,563,352

1,666,155

99.89

116.3

DRS013118

179

2,291,578

2,269,154

1,560,395

93.55

131.8

DRS013119

189

2,010,838

1,967,720

1,664,913

99.82

90.9

DRS013120

F32

5,383,222

5,327,650

1,593,944

95.56

283.6

DRS013121

F44

3,887,082

3,806,902

1,667,084

99.95

157.9

DRS013122

F65

4,248,748

4,157,272

1,667,173

99.95

189.6

DRS013123

F79

3,036,516

3,035,946

1,562,308

93.67

190.1

DRS013124

CLR-resistant

     

S1

2,271,944

2,271,890

1,571,448

94.21

149.2

DRS013125

S2

5,962,628

5,962,428

1,587,965

95.20

342.2

DRS013126

S4

4,640,490

4,640,330

1,578,524

94.64

262.8

DRS013127

S8

10,869,516

10,868,918

1,610,753

96.57

686.3

DRS013128

S13

3,873,394

3,873,000

1,563,976

93.77

264.2

DRS013129

S16

6,782,392

6,781,628

1,594,857

95.62

448.2

DRS013130

S17

5,700,038

5,699,336

1,596,480

95.71

327.3

DRS013131

S22

6,597,254

6,596,450

1,598,844

95.86

426.8

DRS013132

S23

1,820,652

1,820,436

1,559,100

93.47

125.5

DRS013133

S26

6,692,038

6,691,390

1,584,702

95.01

442.9

DRS013134

174

3,004,008

3,003,900

1,580,603

94.76

169.7

DRS013135

194

6,936,714

6,921,552

1,600,238

95.94

415.2

DRS013136

Total reads after trimming are mapped to the reference nucleotide of ATCC26695 and calculated with Genomic Workbench 6.0.1.

Detection of A2146G and A2147G with sequencing reads

Prior to analyzing the target genes in the derived sequence data, we examined the position of point mutations in 23S rRNA to identify any false positive variants. Two identical copies of 23S rRNA (HPr01 and HPr06) are found in the H. pylor i genome [11].

Sequence data of 12 resistant strains mapped to the ATCC26695 reference genome. The results of two representative resistant strains, S17 and S26, are shown in Figure 2. In the S17 strain at position 2146 in the 23S rRNA gene, all sequence reads (479-fold) had the variant G. Similarly, in S26 at position 2147, all reads (485-fold) had the variant G. In the other copy of the 23S rRNA, the same changes were found in each strain. Sequencing reads of the remaining 10 strains also contained the variant G. The AS-PCR is a targeted approach for identifying variants at one base-pair position (i.e., 2146 or 2147), but whole-genome sequencing can simultaneously detect multiple base-pair variants with high confidence. In contrast, there was no variant in the same positions of 23S rRNA genes of 7 CLR-susceptible strains. Representative result of F79 strain was shown in Additional file 3: Figure S3.
Figure 2

A2146G and A2147G mutations in the 23S rRNA gene identified by illumina sequencing. The aligned results of sequencing reads of two CLR-resistant H. pylori strains (S17 and S26) are shown. Along the top, reference nucleotide sequences of NC_000915 (ATCC26695), and consensus nucleotide sequences of each CLR-resistant strain are shown (black). The lower portion of the sequence viewer shows mapped sequencing reads (yellow and blue). In 479 reads from S17 strain (left), reference nucleotide A was changed to G at position 2146 in 23S rRNA (bold faces). Similarly, reference nucleotide A was changed to G at position 2147 in 23S rRNA in 485 reads from S26 (right).

Coding sequence (CDS) variants in efflux pump genes

To identify other possible variants in these clinical isolates, we next examined genetic variants of four gene clusters of TolC homologues, which have been associated with multidrug resistance [23]. To the best of our knowledge, this is the first survey of H. pylori MDR efflux transporter variants. During the filtering of uncertain indels and the analysis of > 99.0% of mapped reads, we created a list of high-quality informative SNVs associated with CDS variants (Table 5).
Table 5

SNVs of multidrug resistant efflux pump genes and MICs of CLR

Strain

MICs of CLR (μg/ml)

hp0605 (hefA )

hp0606 (hefB )

hp0607 (hefC )

hp0969 (hefF )

hp0970 (hefE )

hp097 1 (hefD )

hp1327 (hefG )

hp1328 (hefH )

hp1329 (hefI )

hp1487

hp1488

hp1489

Total

CLR-susceptible

177

-

0

0

0

0

0

0

0

0

0

0

0

0

0

179

-

29

12

70

51

13

3

22

16

47

30

26

31

350

189

-

0

0

0

0

0

0

0

0

0

0

0

0

0

F32

-

48

20

76

83

24

27

0

0

0

0

0

0

278

F44

-

0

0

0

0

0

0

0

0

0

0

0

0

0

F65

-

0

0

0

0

0

0

0

0

0

0

0

0

0

F79

-

39

15

49

55

16

30

0

0

0

0

0

0

204

CLR-resistant

S1

32

32

17

51

55

9

25

23

18

61

23

13

27

354

S2

32

50

18

74

0

0

0

0

0

0

0

0

0

142

S4

32

39

18

67

55

16

26

0

0

0

0

0

0

221

S8

4

44

19

67

0

0

0

0

0

0

0

0

0

130

S13

16

52

21

80

76

22

31

0

0

0

0

0

0

282

S16

16

54

23

81

0

0

0

0

0

0

0

0

0

158

S17

32

48

19

87

0

0

0

0

0

0

0

0

0

154

S22

64

46

16

69

0

0

0

0

0

0

0

0

0

131

S23

16

1

16

21

14

2

8

38

10

71

23

19

42

265

S26

32

55

24

83

0

0

0

0

0

0

0

0

0

162

174

-

40

11

55

58

19

34

26

10

52

27

19

47

398

194

-

25

7

34

48

15

18

0

0

0

0

0

0

147

Statistics

P value

 

0.011

0.017

0.038

NS

NS

NS

NS

NS

NS

NS

NS

NS

NS

95% CI

 

6.1-41.7

2.5-18.8

2.5-69.9

          

NS; not significant.

In 4 of the 7 susceptible strains (177, 189, F44, and F65), there were no SNVs in the MDR efflux pump genes. The other 3 susceptible strains had SNVs in efflux pump genes. In the CLR-susceptible strain 179, there was a total of 350 SNVs across all four clusters of efflux pump genes. In contrast, all CLR-resistant H. pylori strains have SNVs in at least one of the four gene clusters. Particularly, in the hp0605-hp0607 cluster, SNVs were certainly observed in all 12 resistant strains. There were significant differences in SNVs of the hp0605-hp0607 cluster between susceptible and resistant strains (P < 0.05), but not in the other clusters.

Correlations between the total number of SNVs in efflux pump clusters and MICs of CLR were examined. In 10 resistant strains out of 12 isolates, MICs of CLR were ranged from 4 to 64 μg/ml and exhibited over 1 μg/ml with the criteria of CLR resistance (Table 5). We found no significant correlation between SNVs and level of CLR resistance.

To examine the common CDS variant in CLR-resistant H. pylori, further detailed analysis of the SNVs in the hp0605-hp0607 cluster was performed (Table 6). In all CLR-resistant strains, there were no common SNVs in each hp0605, hp0606, and hp0607 cluster. For the maximum number of common SNVs, four SNVs of hp0605 (hefA) were found in 11 out of 12 resistant strains (91.6%). Of note, one CDS variant of Asn177Thr was in 11 resistant strains. In hp0606 and hp0607, there were no CDS variants specific to the resistant strains, though common SNVs in 11 strains (three SNVs in hp0606 and two SNVs in hp0607) were found. These results indicated that independent SNVs in the efflux pump genes may contribute to CLR susceptibility profiles for each strain.
Table 6

SNVs of hp0605-hp0607 cluster in 12 CLR-resistant H. pylori

 

Locus tag

HP0605 (NP_207400.1)

       
 

Annotation

hypothetical protein

       
 

Coding sequence

c.530A > C

 

c.546A > G

 

c.804 T > C

 

c.1365 T > C

 
 

Amino acid

p.Asn177Thr

 

No

 

No

 

No

 
 

Nucleotide positiona

641828

641844

642102

642663

Strain

 

Count reads/Total reads

Frequency (%)

Count reads/Total reads

Frequency (%)

Count reads/Total reads

Frequency (%)

Count reads/Total reads

Frequency (%)

S1

 

179/180

99.4

181/181

100

140/141

99.3

107/107

100

S2

 

373/373

100

392/394

99.5

319/320

99.7

295/295

100

S4

 

212/213

99.5

219/221

99.1

212/214

99.1

204/205

99.5

S8

 

507/508

99.8

530/532

99.6

478/479

99.8

503/506

99.4

S13

 

218/218

100

225/225

100

169/170

99.4

179/179

100

S16

 

343/343

100

371/371

100

325/325

100

312/313

99.7

S17

 

266/266

100

306/306

100

185/186

99.5

246/246

100

S22

 

328/328

100

348/348

100

299/299

100

287/289

99.3

S23

 

-

 

-

 

-

 

-

 

S26

 

341/341

100

368/368

100

321/321

100

310/311

99.7

174

 

123/123

100

124/124

100

114/114

100

151/151

100

194

 

305/306

99.7

324/324

100

341/343

99.4

231/232

99.6

 

Locus tag

HP0606 (NP_207401.1)

       
 

Annotation

membrane fusion protein MtrC

      
 

Coding sequence

c.99 T > C

 

c.105A > G

 

c.192A > G

   
 

Amino acid

No

 

No

 

No

   
 

Nucleotide position

642841

642847

642934

  

Strain

 

Count reads/Total reads

Frequency (%)

Count reads/Total reads

Frequency (%)

Count reads/Total reads

Frequency (%)

  

S1

 

140/140

100

129/129

100

139/140

99.3

  

S2

 

340/340

100

324/324

100

383/385

99.5

  

S4

 

194/194

100

192/193

99.5

221/223

99.1

  

S8

 

496/498

99.6

472/473

99.8

505/506

99.8

  

S13

 

203/203

100

194/194

100

-

   

S16

 

329/331

99.4

316/317

99.7

335/335

100

  

S17

 

233/233

100

230/230

100

272/273

99.6

  

S22

 

295/295

100

285/285

100

320/322

99.4

  

S23

 

109/109

100

105/105

100

110/110

100

  

S26

 

323/325

99.4

311/312

99.7

331/331

100

  

174

 

137/138

99.3

126/127

99.2

137/138

99.3

  

194

 

-

 

-

 

299/301

99.3

  
 

Locus tag

HP0607 (NP_207402.1)

       
 

Annotation

acriflavine resistance protein AcrB

       
 

Coding sequence

c.1341T>C

 

c.39A>G

     
 

Amino acid

No

 

No

     
 

Nucleotide position

644800

643498

    

Strain

 

Count reads/Total reads

Frequency (%)

Count reads/Total reads

Frequency (%)

    

S1

 

159/160

99.4

123/124

99.2

    

S2

 

345/347

99.4

280/280

100

    

S4

 

284/286

99.3

182/182

100

    

S8

 

585/586

99.8

431/432

99.8

    

S13

 

227/228

99.6

164/164

100

    

S16

 

425/425

100

295/295

100

    

S17

 

317/317

100

198/198

100

    

S22

 

346/347

99.7

273/275

99.3

    

S23

 

104/104

100

106/106

100

    

S26

 

419/419

100

295/295

100

    

174

 

113/113

100

-

     

194

 

-

 

342/344

99.4

    

aNucelotide position was based on NC_000915.

Discussion

Here, we have sequenced whole genomes of H. pylori isolates by using the massively parallel illumina-based platform. This MiSeq platform can generate the largest amount of paired-end sequence data per sample using a chip-based bridge amplification procedure followed by sequencing by synthesis [24]. To determine the adequate total reads and average coverage per sample, six different sequencing data sets from ATCC26695 have been analyzed. We have observed that the amount of sequencing reads after trimming was directly proportional to the average coverage from 4.2- to 81.7-fold. Genome depth is a major factor that determines the ability to reconstruct genome sequences and detect genetic variants with low error rate [25]. To reach the necessary balance between the number of total reads and average coverage, over one million reads with depth of over 70-fold is sufficient for identification of genetic variants in the bacterial genome of 1.6 Mb [26, 27].

However, we could not create a complete gap closure to the reference H. pylori genome with sufficient sequencing coverage. Illumina sequencing technique produces large amounts of short overlapping reads from the target genome [28]. The first task of analysis is to assemble these reads to larger regions of the bacterial genome. Since there is an assembly gap, we have reduced the number of false positive candidates and did not try to identify insertions or deletions (indels) of any size in the analysis. Sequencing-based indels detection methods are not well-established even utilizing paired-end data [29], and the reliable detection of indels is complex. In addition, under our approach of reference based assembly, it is difficult to detect true indels due to small assembly gaps even when sequencing the reference genome. Thus, we have selected a conservative analysis method focused on SNVs of H. pylori coding sequence.

In the present study, we have applied the AS-PCR method to detect mutations in the 23S rRNA gene of H. pylori, in which these mutations were perfectly identical in all sequencing reads at the AS-PCR assayed position. AS-PCR utilizes allele-specific primers such that the second nucleotide from the 3′ end is designed to match the site of the point mutation [30]. This AS-PCR assay is well-established to definitely identify whether a H. pylori strain is sensitive or resistant to CLR [31, 32]. Our analysis is a successful comparison between point mutations detected by both AS-PCR and short-read sequencing. Currently, there are few studies in which genetic mutations of antimicrobial resistance identified with sequencing data are consistent with recorded variants [33, 34]. In addition, next-generation sequencing could clearly distinguish a point mutation in the 23S rRNA gene in the H. pylori genome.

To provide future advances for treatment of H. pylori infections, we need to know whether variants of MDR efflux pump genes rely on drug resistance as a species-dependent intrinsic factor. The resistance-nodulation-cell division (RND) family is grouped into MDR efflux pumps in gram-negative bacteria [35]. AcrB protein, a member of the RND family, forms a homotrimer with an outer membrane protein (TolC) and a periplasmic membrane fusion protein (AcrA) [36, 37]. In H. pylori, two TolC homologs, hp0605 and hp1489, have been identified on the basis of structural similarities with outer membrane efflux protein formed RND domains [38]. In addition, three RND efflux systems, each of which consists of an accessory protein of translocase, have been identified as TolC homolog [39]. Now, four gene clusters of efflux pump systems (hp0605-hp0607, hp0971-hp0969, hp1327-hp1329, and hp1489-hp1487) are identified in H. pylori[23] and possibly contribute to resistance to antimicrobials, which resemble the situation in other bacteria [40]. Expression analysis in clinical isolates has shown the importance of efflux pump genes to antimicrobial agents. In response to the exposure of metronidazole, expression of TolC efflux pump gene (hp0605) has been shown to increase, indicating the relation with drug resistance in H. pylori[41]. More recently, exposure of CLR in vitro has induced natural transformation to the genome of strain 26695, which resulted in the point mutation of acrB (hp0607) with whole-genome sequencing [42]. To extend these previous findings, this study highlights the importance of MDR efflux pumps of H. pylori derived from active infections.

This study has indicated a link between specific variants of efflux pump genes and the CLR-resistant phenotype. The exact mechanism underlying these genetic mutations is unclear. Possible mechanisms of intrinsic drug resistance involve decreased drug uptake or increased drug efflux [39]. Knockout mutants for each of hp0605 and hp0971 have displayed drug susceptibility profiles to metronidazole, novobiocin, and sodium deoxycholate [23]. Indeed, we have found that specific mutations in hp0605, hp0971, and the other variants in efflux pump systems are significant in CLR-resistant strains. Whole-genome sequencing data include vast amounts of additional information that are currently unavailable from small scale analysis. Variants in efflux pump genes have a possible effect on the association with drug susceptibility in clinical isolates.

Conclusions

We have provided successful validation of genotypic prediction for antimicrobial resistance with the PCR-based approach and highlighted the potential of whole-genome sequencing in the analysis of H. pylori isolates. These sequencing data have emphasized the significant function of the variants of efflux pump genes in CLR-resistant strains. Since we have been conservative in our analysis to focus on only well-validated SNVs in limited parts of the bacterial genome, further analyses (e.g., indels, short repeats, rearrangements, and phylogenetics) with whole genome methods, such as gap closure, could provide more detailed discrimination of the drug resistant H. pylori isolates.

Methods

H.pylori samples

Nineteen H. pylori clinical isolates were separated from gastric epithelium biopsy tissues during upper gastroduodenal endoscopy at Okinawa Prefectural Chubu Hospita, and Kobe University Hospital. All patients gave written informed consent for use of their samples for the present study, and this study was performed according to the principles of the Declaration of Helsinki. The major reference strain, ATCC26695 (NC_000915), was also used.

H.pylori culture

Gastric biopsy specimens were transferred onto a Trypticase soy agar II (TSA-II)-5% sheep blood plate and cultured under microaerobic conditions (O2, 5%; CO2, 15%; N2, 80%) at 37°C for 5 days. One colony was picked from each primary culture plate, and seeded onto a fresh TSA-II plate. A few colonies were picked from each plate and transferred into 2 ml of brucella broth liquid culture medium containing 10% fetal calf serum and cultured for 3 days. A part of the liquid culture was stored at -80°C in 0.01 M PBS containing 20% glycerol. H. pylori DNA was extracted from the pellet of the liquid culture by the protease-phenol-chloroform method, suspended in 300 μl of TE buffer, and stored at 4°C until AS-PCR and sequencing.

Antibiotic susceptibility testing

To determine the MICs of CLR, CLSI agar dilution method was used [43]. Briefly, two-fold dilutions of CLR were prepared in Muller-Hinton agar (Becton Dickinson, MD) with 5% sheep blood. Following the preparation of H. pylori suspension in physiological saline adjusted to a 2.0 McFarland standard, a 1 to 3 μl inoculum was spotted on agar plate. Following incubation at 37°C for 72 h under microaerophilic atomosphere, the MICs of CLR were established as the drug concentration showing no growth.

Allele-specific PCR (AS-PCR) for 23S rRNA gene mutations

Analysis of alleles with point mutations in 23S rRNA (A2146G and A2147G) was performed according to previous reports [31, 32]. The allele-specific primer sequences are listed in Additional file 4: Table S1. The PCR mixture was contained 100 ng of DNA with 10 × buffer 2.5 μl, 2 mM dNTP 2.5 μl, 25 mM MgCl2 1 μl, 10 pmol primer mixtures, and 0.5 U KOD-plus DNA polymerase (TOYOBO, Osaka, Japan). Then, mixture was up to 25 μl with distilled water. The PCR condition was as follows; 94°C for 2 min and 35 cycles of 94°C for 15 sec, 60°C for 30 sec, and 68°C for 30 sec, followed by 68°C for 2 min. PCR products were determined by 4% agarose gel electrophoresis. The gels were stained with ethidium bromide to determine the product size. ATCC26695 and J99 were used as control strains for the AS-PCR.

Preparation of genomic DNA and whole-genome sequencing

Total DNA of H. pylori isolated from patients and the reference ATCC26695 were sequenced. Bacterial DNA was extracted with DNeasy blood and tissue kit according to manufacturer’s guideline (Qiagen, Hilden, Germany). DNA concentration of each sample was measured with Qubit dsDNA HS assay kit (Q32851; Invitrogen, Carlsbad, CA). An <500-bp DNA library of H. pylori strains (50 ng or 1 ng) was prepared by using Nextera DNA Sample Prep Kit (illumina, San Diego, CA) or Nextera XT DNA Sample Prep Kit (illumina). According to the manufacturer’s instructions (version May 2012), DNA was uniformly sheared into 500-bp portions with these kits, and DNA libraries were pooled with 1% 8 pM PhiX control Spike in, and then run on MiSeq sequencer (illumina) with Reagent kit (300 cycle, paired-end). Fluorescent images were analyzed using the MiSeq Control Software, and FASTQ-formatted sequence data was created using MiSeq Reporter Analysis.

Sequence reads mapping and SNVs detection

For used sequence data, read quality was selected at Q30 over 80% followed by the suggestion of illumina. After quality check and data trimming, Genomics Workbench 6.0.1 (CLC bio, Aarhus, Denmark) was used to assemble the sequence. The read mapping module was termed as CLC Assembly Cell 4.0, which was based on an uncompressed Suffix-Array representing the entire reference genome in a single data structure (White paper on CLC read mapper; October 10, 2012). Sequence reads were mapped against the reference genome of ATCC26695 (NC_000915), and single nucleotide variants (SNVs) were identified with probabilistic variant detection modules with default parameters and minor modifications in the mapping algorithm. Variant detection was set to 1 in Genomics Workbench 6.0.1. To exclude false-positive variants resulting from sequencing errors, we selected variants presented in > 99.0% of mapped reads with minimum coverage of 100. Insertions and deletions were also discarded. During this process, a set of high confidence variants was generated.

Variants of MDR efflux pumps in clinical H. pylori strains

Generally, in gram-negative bacteria, the resistance-nodulation-cell division (RND) family is representative of MDR efflux pumps, which includes the AcrAB-TolC system in Escherichia coli[35]. In the H. pylori 26695 genome, four gene clusters of TolC homologues, hp0605-hp0607 (hefABC), hp0971-hp0969 (hefDEF), hp1327-hp1329 (hefGHI), and hp1489-hp1487, have been indicated as MDR efflux pumps based on sequence similarity to other bacterial species [23] and their gene expression patterns [16].

Statistical analysis

The associations between the genetic variants of efflux pump genes and the phenotype of CLR resistance were analyzed with Student’s t-test. Correlation coefficient between the genetic variants and MICs of CLR was also calculated, and the 95% confidence interval (CI) was used to estimate the risk. A P value of <0.05 was accepted as statistically significant. The SPSS statistical software package version 20.0 (SPSS, Inc., Chicago, IL) was used for all statistical analyses.

Nucleotide sequence accession number

All sequence reads of 19 clinical isolates and ATCC26695 have been deposited in the DNA Data Bank of Japan Sequence Read Archive (http://www.ddbj.nig.ac.jp/index-e.html) under accession number DRA001250.

Declarations

Acknowledgements

This study was supported by a Grant-in-Aid (no. 26460212) to TT from the Ministry of Education, Culture, Sports, Science and Technology of Japan, JSPS Grant-in-Aid for Scientific Research on Innovative Areas (no. 22114006) to TA, JSPS Grants-in-Aid for Scientific Research (no. 25305027) to TA, and JSPS Asian CORE Program to TA. TT and YM were financially supported by the Ministry of Health, Labour, and Welfare of Japan (H25-general-008). This study was also supported by Toyobo Co. Ltd. (Osaka, Japan).

Authors’ Affiliations

(1)
Department of Internal Medicine, Division of Gastroenterology, Kobe University Graduate School of Medicine
(2)
Department of Medical Pharmaceutics, Kobe Pharmaceutical University
(3)
Division of Internal Medicine, Okinawa Prefectural Chubu Hospital
(4)
Department of Hepatology, Osaka City University Graduate School of Medicine
(5)
Department of Internal Medicine, Division of Gastroenterology, Kobe University Graduate School of Medicine

References

  1. Gisbert JP, Calvet X: Review article: the effectiveness of standard triple therapy for Helicobacter pylori has not changed over the last decade, but it is not good enough. Aliment Pharmacol Ther. 2011, 34: 1255-1268.View ArticlePubMedGoogle Scholar
  2. McColl KE: Clinical practice. Helicobacter pylori infection. N Engl J Med. 2010, 362: 1597-1604.View ArticlePubMedGoogle Scholar
  3. Malfertheiner P, Megraud F, O’Morain C, Bazzoli F, El-Omar E, Graham D, Hunt R, Rokkas T, Vakil N, Kuipers EJ: Current concepts in the management of Helicobacter pylori infection: the Maastricht III Consensus Report. Gut. 2007, 56: 772-781.PubMed CentralView ArticlePubMedGoogle Scholar
  4. Gisbert JP, Calvet X, Gomollon F, Mones J: [Eradication treatment of Helicobacter pylori. Recommendations of the II Spanish Consensus Conference]. Med Clin (Barc). 2005, 125: 301-316.View ArticleGoogle Scholar
  5. Caselli M, Zullo A, Maconi G, Parente F, Alvisi V, Casetti T, Sorrentino D, Gasbarrini G: “Cervia II Working Group Report 2006”: guidelines on diagnosis and treatment of Helicobacter pylori infection in Italy. Dig Liver Dis. 2007, 39: 782-789.View ArticlePubMedGoogle Scholar
  6. Chey WD, Wong BC: American College of Gastroenterology guideline on the management of Helicobacter pylori infection. Am J Gastroenterol. 2007, 102: 1808-1825.View ArticlePubMedGoogle Scholar
  7. Jenks PJ: Causes of failure of eradication of Helicobacter pylori. BMJ. 2002, 325: 3-4.PubMed CentralView ArticlePubMedGoogle Scholar
  8. Vakil N, Megraud F: Eradication therapy for Helicobacter pylori. Gastroenterology. 2007, 133: 985-1001.View ArticlePubMedGoogle Scholar
  9. Graham DY, Lu H, Yamaoka Y: A report card to grade Helicobacter pylori therapy. Helicobacter. 2007, 12: 275-278.View ArticlePubMedGoogle Scholar
  10. Versalovic J, Shortridge D, Kibler K, Griffy MV, Beyer J, Flamm RK, Tanaka SK, Graham DY, Go MF: Mutations in 23S rRNA are associated with clarithromycin resistance in Helicobacter pylori. Antimicrob Agents Chemother. 1996, 40: 477-480.PubMed CentralPubMedGoogle Scholar
  11. Taylor DE, Ge Z, Purych D, Lo T, Hiratsuka K: Cloning and sequence analysis of two copies of a 23S rRNA gene from Helicobacter pylori and association of clarithromycin resistance with 23S rRNA mutations. Antimicrob Agents Chemother. 1997, 41: 2621-2628.PubMed CentralPubMedGoogle Scholar
  12. Rimbara E, Noguchi N, Kawai T, Sasatsu M: Novel mutation in 23S rRNA that confers low-level resistance to clarithromycin in Helicobacter pylori. Antimicrob Agents Chemother. 2008, 52: 3465-3466.PubMed CentralView ArticlePubMedGoogle Scholar
  13. Kim JM, Kim JS, Kim N, Kim YJ, Kim IY, Chee YJ, Lee CH, Jung HC: Gene mutations of 23S rRNA associated with clarithromycin resistance in Helicobacter pylori strains isolated from Korean patients. J Microbiol Biotechnol. 2008, 18: 1584-1589.PubMedGoogle Scholar
  14. Nash KA, Brown-Elliott BA, Wallace RJ: A novel gene, erm(41), confers inducible macrolide resistance to clinical isolates of Mycobacterium abscessus but is absent from Mycobacterium chelonae. Antimicrob Agents Chemother. 2009, 53: 1367-1376.PubMed CentralView ArticlePubMedGoogle Scholar
  15. Roberts M: Update on macrolide-lincosamide-streptogramin, ketolide, and oxazolidinone resistance genes. FEMS Microbiol Lett. 2008, 282: 147-159.View ArticlePubMedGoogle Scholar
  16. Hirata K, Suzuki H, Nishizawa T, Tsugawa H, Muraoka H, Saito Y, Matsuzaki J, Hibi T: Contribution of efflux pumps to clarithromycin resistance in Helicobacter pylori. J Gastroenterol Hepatol. 2010, 25 (Suppl 1): S75-S79.View ArticlePubMedGoogle Scholar
  17. De Francesco V, Margiotta M, Zullo A, Hassan C, Valle ND, Burattini O, D’Angelo R, Stoppino G, Cea U, Giorgio F, Monno R, Morini S, Panella C, Ierardi E: Claritromycin resistance and Helicobacter pylori genotypes in Italy. J Microbiol. 2006, 44: 660-664.PubMedGoogle Scholar
  18. Tanuma M, Rimbara E, Noguchi N, Boonyaritichaikij S, Kuwabara K, Fukunaga Y, Sasatsu M: Analysis of clarithromycin resistance and CagA status in Helicobacter pylori by use of feces from children in Thailand. J Clin Microbiol. 2009, 47: 4144-4145.PubMed CentralView ArticlePubMedGoogle Scholar
  19. MacLean D, Jones JD, Studholme DJ: Application of ‘next-generation’ sequencing technologies to microbial genetics. Nat Rev Microbiol. 2009, 7: 287-296.PubMedGoogle Scholar
  20. Didelot X, Bowden R, Wilson DJ, Peto TE, Crook DW: Transforming clinical microbiology with bacterial genome sequencing. Nat Rev Genet. 2012, 13: 601-612.View ArticlePubMedGoogle Scholar
  21. Loman NJ, Constantinidou C, Chan JZ, Halachev M, Sergeant M, Penn CW, Robinson ER, Pallen MJ: High-throughput bacterial genome sequencing: an embarrassment of choice, a world of opportunity. Nat Rev Microbiol. 2012, 10: 599-606.View ArticlePubMedGoogle Scholar
  22. Koser CU, Ellington MJ, Cartwright EJ, Gillespie SH, Brown NM, Farrington M, Holden MT, Dougan G, Bentley SD, Parkhill J, Peacock SJ: Routine use of microbial whole genome sequencing in diagnostic and public health microbiology. PLoS Pathog. 2012, 8: e1002824.PubMed CentralView ArticlePubMedGoogle Scholar
  23. van Amsterdam K, Bart A, van der Ende A: A Helicobacter pylori TolC efflux pump confers resistance to metronidazole. Antimicrob Agents Chemother. 2005, 49: 1477-1482.PubMed CentralView ArticlePubMedGoogle Scholar
  24. Bentley DR, Balasubramanian S, Swerdlow HP, Smith GP, Milton J, Brown CG, Hall KP, Evers DJ, Barnes CL, Bignell HR, Boutell JM, Bryant J, Carter RJ, Keira Cheetham R, Cox AJ, Ellis DJ, Flatbush MR, Gormley NA, Humphray SJ, Irving LJ, Karbelashvili MS, Kirk SM, Li H, Liu X, Maisinger KS, Murray LJ, Obradovic B, Ost T, Parkinson ML, Pratt MR: Accurate whole human genome sequencing using reversible terminator chemistry. Nature. 2008, 456: 53-59.PubMed CentralView ArticlePubMedGoogle Scholar
  25. Clark MJ, Chen R, Lam HY, Karczewski KJ, Chen R, Euskirchen G, Butte AJ, Snyder M: Performance comparison of exome DNA sequencing technologies. Nat Biotechnol. 2011, 29: 908-914.PubMed CentralView ArticlePubMedGoogle Scholar
  26. Howden BP, McEvoy CR, Allen DL, Chua K, Gao W, Harrison PF, Bell J, Coombs G, Bennett-Wood V, Porter JL, Robins-Browne R, Davies JK, Seemann T, Stinear TP: Evolution of multidrug resistance during Staphylococcus aureus infection involves mutation of the essential two component regulator WalKR. PLoS Pathog. 2011, 7: e1002359.PubMed CentralView ArticlePubMedGoogle Scholar
  27. Perkins TT, Tay CY, Thirriot F, Marshall B: Choosing a benchtop sequencing machine to characterise Helicobacter pylori genomes. PLoS One. 2013, 8: e67539.PubMed CentralView ArticlePubMedGoogle Scholar
  28. Quail MA, Smith M, Coupland P, Otto TD, Harris SR, Connor TR, Bertoni A, Swerdlow HP, Gu Y: A tale of three next generation sequencing platforms: comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers. BMC Genomics. 2012, 13: 341.PubMed CentralView ArticlePubMedGoogle Scholar
  29. Emde AK, Schulz MH, Weese D, Sun R, Vingron M, Kalscheuer VM, Haas SA, Reinert K: Detecting genomic indel variants with exact breakpoints in single- and paired-end sequencing data using SplazerS. Bioinformatics. 2012, 28: 619-627.View ArticlePubMedGoogle Scholar
  30. Nishizawa T, Suzuki H, Umezawa A, Muraoka H, Iwasaki E, Masaoka T, Kobayashi I, Hibi T: Rapid detection of point mutations conferring resistance to fluoroquinolone in gyrA of Helicobacter pylori by allele-specific PCR. J Clin Microbiol. 2007, 45: 303-305.PubMed CentralView ArticlePubMedGoogle Scholar
  31. Nakamura A, Furuta T, Shirai N, Sugimoto M, Kajimura M, Soya Y, Hishida A: Determination of mutations of the 23S rRNA gene of Helicobacter pylori by allele specific primer-polymerase chain reaction method. J Gastroenterol Hepatol. 2007, 22: 1057-1063.View ArticlePubMedGoogle Scholar
  32. Furuta T, Soya Y, Sugimoto M, Shirai N, Nakamura A, Kodaira C, Nishino M, Okuda M, Okimoto T, Murakami K, Fujioka T, Hishida A: Modified allele-specific primer-polymerase chain reaction method for analysis of susceptibility of Helicobacter pylori strains to clarithromycin. J Gastroenterol Hepatol. 2007, 22: 1810-1815.View ArticlePubMedGoogle Scholar
  33. McAdam PR, Holmes A, Templeton KE, Fitzgerald JR: Adaptive evolution of Staphylococcus aureus during chronic endobronchial infection of a cystic fibrosis patient. PLoS One. 2011, 6: e24301.PubMed CentralView ArticlePubMedGoogle Scholar
  34. Mutreja A, Kim DW, Thomson NR, Connor TR, Lee JH, Kariuki S, Croucher NJ, Choi SY, Harris SR, Lebens M, Niyogi SK, Kim EJ, Ramamurthy T, Chun J, Wood JL, Clemens JD, Czerkinsky C, Nair GB, Holmgren J, Parkhill J, Dougan G: Evidence for several waves of global transmission in the seventh cholera pandemic. Nature. 2011, 477: 462-465.PubMed CentralView ArticlePubMedGoogle Scholar
  35. Okusu H, Ma D, Nikaido H: AcrAB efflux pump plays a major role in the antibiotic resistance phenotype of Escherichia coli multiple-antibiotic-resistance (Mar) mutants. J Bacteriol. 1996, 178: 306-308.PubMed CentralPubMedGoogle Scholar
  36. Murakami S, Nakashima R, Yamashita E, Yamaguchi A: Crystal structure of bacterial multidrug efflux transporter AcrB. Nature. 2002, 419: 587-593.View ArticlePubMedGoogle Scholar
  37. Nakashima R, Sakurai K, Yamasaki S, Nishino K, Yamaguchi A: Structures of the multidrug exporter AcrB reveal a proximal multisite drug-binding pocket. Nature. 2011, 480: 565-569.PubMedGoogle Scholar
  38. Johnson JM, Church GM: Alignment and structure prediction of divergent protein families: periplasmic and outer membrane proteins of bacterial efflux pumps. J Mol Biol. 1999, 287: 695-715.View ArticlePubMedGoogle Scholar
  39. Bina JE, Alm RA, Uria-Nickelsen M, Thomas SR, Trust TJ, Hancock RE: Helicobacter pylori uptake and efflux: basis for intrinsic susceptibility to antibiotics in vitro. Antimicrob Agents Chemother. 2000, 44: 248-254.PubMed CentralView ArticlePubMedGoogle Scholar
  40. Alvarez-Ortega C, Olivares J, Martinez JL: RND multidrug efflux pumps: what are they good for?. Front Microbiol. 2013, 4: 7-PubMed CentralView ArticlePubMedGoogle Scholar
  41. Tsugawa H, Suzuki H, Muraoka H, Ikeda F, Hirata K, Matsuzaki J, Saito Y, Hibi T: Enhanced bacterial efflux system is the first step to the development of metronidazole resistance in Helicobacter pylori. Biochem Biophys Res Commun. 2011, 404: 656-660.View ArticlePubMedGoogle Scholar
  42. Binh TT, Shiota S, Suzuki R, Matsuda M, Trang TT, Kwon DH, Iwatani S, Yamaoka Y: Discovery of novel mutations for clarithromycin resistance in Helicobacter pylori by using next-generation sequencing. J Antimicrob Chemother. 2014, [Epub ahead of print]Google Scholar
  43. Clinical and Laboratory Standards Institute: Performance Standards for Antimicrobial Susceptibility Testing: Seventeenth Informational Supplement M100-S17.In CLSI. PA, USA: Wayne; 2007.Google Scholar

Copyright

© Iwamoto et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.