Skip to main content

Table 4 Quantitative polymerase chain reaction (qPCR) primes used in this study to enumerate specific bacterial species.

From: Luminal and mucosal-associated intestinal microbiota in patients with diarrhea-predominant irritable bowel syndrome

Bacterial species   Primer Sequence 5'-3' Annealing temperature (°C) PCR Product size (bp)
Bacteroides spp.a F-
R-
ATAGCCTTTCGAAAGRAAGAT
CCAGTATCAACTGCAATTTTA
50 495
Clostridium spp.b F-
R-
CGGTACCTGACTAAGAAGC
AGTTTYATTCTTGCGAACG
50 429
Escherichia coli c F-
R-
GTTAATACCTTTGCTCATTGA
ACCAGGGTATCTAATCCTGTT
52 340
Bifidobacterium spp.d F-
R-
GGGTGGTAATGCCGGATG
TAAGCGATGGACTTTCACACC
55 442
Lactobacillus spp.e F-
R-
AGCAGTAGGGAATCTTCCA
CACCGCTACACATGGAG
50 341
  1. aprimers from Matsuki et al.,[26]
  2. bprimers from Rinttila et al.,[27]
  3. cprimers from Malinen et al.,[28]
  4. dprimers from Bartoch et al.,[29]
  5. eprimers from Maeda et al.,[30]