Skip to main content

Table 2 Real-time PCR assays of the pathogen panel applied in this study.

From: Real-time PCR analysis of enteric pathogens from fecal samples of irritable bowel syndrome subjects

PCR assay
(Target gene)
Sequence (5'-> 3') Amplicon size
(bp)
Ta
(°C)
MgCl2
(mM)
Reference
Aeromonas spp.
(aerA)
F: GAGAAGGTGACCACCAAGAACA
R: AACTGACATCGGCCTTGAACTC
232 61 2 [57]
Bacillus cereus group
(16S rRNA)
F: TCGAAATTGAAAGGCGGC
R: GGTGCCAGCTTATTCAAC
288 64 3 [58]
Campylobacter jejuni
(hipO)
F: GACTTCGTGCAGATATGGATGCTT
R: GCTATAACTATCCGAAGAAGCCATCA
344 58 3 [59]
Clostridium difficile
(16S rRNA)
F: TTGAGCGATTTACTTCGGTAAAGA
R: CCATCCTGTACTGGCTCACCT
157 58 3 [55]
Clostridium perfringens
(plc)
F: AAGTTACCTTTGCTGCATAATCCC
R: ATAGATACTCCATATCATCCTGCT
283 61 4 [60]
Clostridium perfringens
(cpe)
F: GGTTCATTAATTGAAACTGGTG
R: AACGCCAATCATATAAATTACAGC
154 58 3 [61]
EHEC/EPEC
(eaeA)
F: ATGCTTAGTGCTGGTTTAGG
R: GCCTTCATCATTTCGCTTTC
248 65 4 [62]
Helicobacter pylori
(16S rRNA)
F: GAAGATAATGACGGTATCTAAC
R: ATTTCACACCTGACTGACTAT
139 58 4 [55]
Listeria monocytogenes
(iap)
F: CTAAAGCGGGAATCTCCCTT
R: CCATTGTCTTGCGCGTTAAT
174 61 4 [63]
Salmonella spp.
(invA)
F: GTGAAATTATCGCCACGTTCGGGCAA
R: TCATCGCACCGTCAAAGGAACC
281 64 2 [64]
Staphylococcus aureus
(nuc)
F: GCGATTGATGGTGATACGGTT
R: AGCCAAGCCTTGACGAACTAAAGC
279 60 3 [65]
Yersinia enterocolitica
(ail)
F: GGTCATGGTGATGTTGATTACTATTCA
R: CGGCCCCCAGTAATCCATAA
90 58 4 [66]