Skip to main content

Table 1 Primer sets for the pathotypes and virulence genes for the E. coli and Salmonella spp.

From: Molecular basis of virulence in clinical isolates of Escherichia coli and Salmonella species from a tertiary hospital in the Eastern Cape, South Africa

Isolate species/subgroups Target gene Primer Nucleotide Sequence (5'- 3') Amplicon size (bp) Reference
E. coli
EPEC and EHEC eaeA EAE-a ATGCTTAGTGCTGGTTTAGG 248 [63]
   EAE-b GCCTTCATCATTTCGCTTTC   
EHEC stx 1 JMS1-F GTCACAGTAACAAACCGTAACA 95 [64]
   JMS1-R TCGTTGACTACTTCTTATCTGGA   
ETEC LT LT-1 AGCAGGTTTCCCACCGGATCACCA 132 [65]
  ST LT-2 GTGCTCAGATTCTGGGTCTC 190 [66]
   STa-F GCTAATGTTGGCAATTTTTATTTCTGTA   
   STa-R AGGATTACAACAAAGTTCACAGCAGTAA   
EAEC aggR AggRks1 GTATACACAAAAGAAGGAAGC 254 [67]
  astA aggRkas2 ACAGAATCGTCAGCATCAGC 106 [68]
   EAST-1S GCCATCAACACAGTATATCC   
   EAST-1AS GAGTGACGGCTTTGTAGTCC   
EIEC VirA virA-F CTGCATTCTGGCAATCTCTTCACA 215 [69]
   virA-R TGATGAGCTAACTTCGTAAGCCCTCC   
Salmonella
  invA invA 139 GTGAAATTATCGCCACGTTCGGGCAA 284 [70]
   invA 141 TCATCGCACCGTCAAAGGAACC   
  sefA S1 GCC GTA CAC GAG CTT ATA GA 250 [71]
   S4 ACC TAC AGG GGC ACA ATA AC   
  fliC Fli15 CGG TGT TGC CCA GGT TGG TAA T 620 [72]
   Typ04 ACT GGT AAA GAT GGC T   
  1. flic-flagellin H1; invA-invasion; sefA- fimbrial antigen; aggR- transcriptional activator for EAEC aggregative adherence fimbria I expression; eaeA-E. coli attaching and effacing; astA-EAEC heat-stable enterotoxin; LT- heat-labile enterotoxin; ST- heat-stable enterotoxin; VirA- virulence plasmid.