Skip to main content

Table 4 16S rRNA gene-targeted group specific primers per bacterial group/species used in this study

From: Differences in gut microbiota composition between obese and lean children: a cross-sectional study

Target Primer sequence (5’-3’) Reference strains Annealing temp (°C) Reference
Bacteroidetes     
Bacteroides-Prevotella-Porphyromonas spp. GGTGTCGGCTTAAGTGCCAT Bacteroides fragilis DSM 2151/LMG 10263 68 [31]
CGGA(C/T)GTAAGGGCCGTGC
Firmicutes     
Staphylococcus spp. GCGATTGATGGTGATACG Staphylococcus aureus ATCC 29213 55 [29]
  AGCCAAGCCTTFACGAACTAAAGC    
Clostridium coccoides-Eubacterium rectale group (clostridial cluster XIV) CGGTACCTGACTAAGAAGC Ruminococcus productus DSM 2950/YIT 6141 55 [31]
  AGTTT(C/T)ATTCTTGCGAACG    
C. leptum group (clostridial cluster IV) GCACAAGCAGTGGAGT Faecalibacterium prausnitzii YIT 6174 50 [30]
  TTCCTCCGTTTTGTCAA    
Lactobacillus spp. AGCAGTAGGGAATCTTCCA Lactobacillus acidophilus LMG 9433 58 [31]
  CACCGCTACACATGGAG    
Actinobacteria     
Bifidobacterium spp. TCGCGTC(C/T)GGTGTGAAAG Bifidobacterium longum DSM 20219/YIT 4021 58 [31]
CCACATCCAGC(A/G)TCCAC