Skip to main content

Table 3 Primers used in the study

From: In vitro evaluation of anti-infective activity of a Lactobacillus plantarum strain against Salmonella enterica serovar Enteritidis

Primer Sequence (5′ to 3′) Reference
hilA F TTAACATGTCGCCAAACAGC [37]
hilA R GCAAACTCCCGACGATGTAT [37]
16s rRNA F GATCATGGCTCAGATTGAACGCTGGCGG [37]
16s rRNA R CACCGCTACACCTGGAATTATACCCCCTC [37]
FwKOSenSodC TTTTATGGGTAAAACGAAATTATGACGATATGGCTATGTTGCTGTGTGTAGGCTGGAGCTGCTTC In this study
RwKOSenSodC TTTTATTAATGGTATTTACGATACAACCAAAAAACGAGGTAACTAATATGAATATCCTCCTTAGTT In this study