Skip to main content

Table 2 Used primers and probes

From: Time-dependent post mortem changes in the composition of intestinal bacteria using real-time quantitative PCR

Primer and probe Sequence (5′-3′) Reference
Bacteroides sp.   [14]
Forward TGGTAGTCCACACAGTAAACGATGA  
Reverse CGTACTCCCCAGGTGGAATACTT  
Probe GTTTGCCATATACAGTAAGCGGCCAAGCG  
Bifidobacterium sp . [15]
Forward CGGGTGAGTAATGCGTGACC  
Reverse TGATAGGACGCGACCCCA  
Probe CTCCTGGAAACGGGTG  
Clostridium leptum   [15]
Forward CCTTCCGTGCCGSAGTTA  
Reverse GAATTAAACCACATACTCCACTGCTT  
Probe CACAATAAGTAATCCACC  
Clostridium coccoides [15]
Forward GACGCCGCGTGAAGGA  
Reverse AGCCCCAGCCTTTCACATC  
Probe CGGTACCTGACTAAGAAG  
Enterobactericaea   This study
Forward GCGGTAGCACAGAGAGCTT  
Reverse GGCAGTTTCCCAGACATTACTCA  
Probe CCGCCGCTCGTCACC  
Lactobacillus sp. This study
Forward GCTAGGTGTTGGAGGGTTTCC  
Reverse CCAGGCGGAATGCTTAATGC  
Probe TCAGTGCCGCAGCTAA  
Streptococcus sp. mainly Str. mitis- group* [13]
Forward CCAGCAGCCGCGGTAATA  
Reverse CCTGCGCTCGCTTTACG  
Probe ACGCTCGGGACCTACG  
Universal   [16]
Forward TGGAGCATGTGGTTTAATTCGA  
Reverse TGCGGGACTTAACCCAACA  
Probe CACGAGCTGACGACA[A/G]CCATGCA  
  1. *This was abbreviated as Streptococcus sp. in the text.