Skip to main content

Table 1 Primers and amplification conditions used in this study

From: The virulence phenotypes and molecular epidemiological characteristics of Vibrio fluvialis in China

Primer Sequences (5’-3’) Target size (bp) Annealing temp. (°C) Reference
toxR-F GACCAGGGCTTTGAGGTGGACGAC 217 65 [32]
toxR-R AGGATACGGCACTTGAGTAAGACTC    
VFLU-F ATAAAGTGAAGAGATTCGTACC 278 60 [33]
VFLU-R GTATTCCTGAATGGAATACAC    
Int IV-F AACACCGCTTGCACCTCTAT 525 53 [34]
Int IV-R TGTATGCGCTTGAGAGTCC    
stn-F GGTGCAACATAATAAACAGTCAACAA 375 53 [44]
stn-R TAGTGGTATGCGTTGCCAGC    
sul II-F AGGGGGCAGATGTGATCGAC 606 55 [35]
sul II-B TGTGCGGATGAAGTCAGCTCC    
vfh-F GCGCGTCAGTGGTGGTGAAG 800 61 This study
vfh-R TCGGTCGAACCGCTCTCGCTT    
hupO-F ATTACGCACAACGAGTCGAAC 600 56 This study
hupO-R ATTGAGATGGT AAACAGCGCC    
vfpA -F TACAACGTCAAGTTAAAGGC 1790 55 This study
vfpA -R GTAGGCGCTGTAGCCTTTCA    
arc- F AGTTTATGCGTCTGGCTTG 3427 56 This study
arc-R ATGAGTAAGTTATACGTAGG    
arc-rev GCTTCGGCCCACATAATAA (paired with arc-F) 2170 56 This study
arc-ck-up TTACCACCTAATGCGACGA (paired with arc-R) 1235 56 This study