Skip to main content

Table 2 PCR primers and probes in this assay

From: Detection, identification and quantification of Campylobacter jejuni, coli and lari in food matrices all at once using multiplex qPCR

Species Target/GeneBank ID Primer/probe DNA sequence 5’→3’ Position within target Amplicon (bp) Reference
C. jejuni hip Oa NC_002163.1 Forward TGCACCAGTGACTATGAATAACGA 809-832 124  
Reverse TCCAAAATCCTCACTTGCCATT 911-932 He et al., 2010 [28]
C. coli gly Ab AF136494.1 Forward CATATTGTAAAACCAAAGCTTATCGTG 271-297 133  
Reverse AGTCCAGCAATGTGTGCAATG 384-404 LaGier et al., 2004* [18]
C. lari pep Tc NC_012039.1 Forward TTAGATTGTTGTGAAATAGGCGAGTT 519-544 86  
Reverse TGAGCTGATTTGCCTATAAATTCG 581-604 He et al., 2010* [28]
   Probe CY5-TGAAAATTGGAAdC GdC AGGTG-BHQ 551-570   
  1. ahippurate hydrolase.
  2. bserine hydroxymethyltransferase.
  3. cpeptidase T.
  4. dC internal modification propynyl dC.
  5. *alteration from reference study.