Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Oligonucleotides used in this study

From: Role of Campylobacter jejuni gamma-glutamyl transpeptidase on epithelial cell apoptosis and lymphocyte proliferation

Oligonucleotides (size)   Sequence (5′-3′)
F-GGT (23 bp) GGGTAAATAAGAAGTTAGAATTC
R-GGT (21 bp) CTTGATAAAGGCGGAAATGCC
F1GGT (20 bp) TGCTTTGGCTGTAGTGCATC
R1GGT (20 bp) TGCTTACAGCATTGCCTTTG
F2GGT (20 bp) TAGGCTTTTTGCGGTGGTAG
R2GGT (20 bp) CAGGAGATCCTGTGCCTGTG
F3GGT (21 bp) TTATCGCAAAGGAAGGTCCTG
R3GGT (20 bp) AGCATCAGGACCTTCCTTTG
  1. bp: base pairs.