Skip to main content

Table 2 Assemble gaps of ATCC26695 sequence data from sample 6

From: Whole-genome sequencing of clarithromycin resistant Helicobacter pylori characterizes unidentified variants of multidrug resistant efflux pump genes

Type Length (bp) Sequence Nucleotide position in reference sequence Locus tag Locus_tag (5' ? 3') Annotation Coverage
   Insertion Deletion Start End     Insertion: consensus side/Deletion: reference side
Short insertion
1 1 A   39762 39763 HP0041 hypothetical protein 63
2 1 G   159581 159582 HP0147 cytochrome c oxidase, diheme subunit, membrane-bound (fixP) 89
3 1 C   173256 173257 HP0165 hypothetical protein 94
4 1 G   208167 208168 HP0203 hypothetical protein 85
5 1 C   263286 263287 HP0253 hypothetical protein 105
6 1 C   331675 331676     2
7 1 T   331678 331679     2
8 1 G   331680 331681     2
9 1 T   331682 331683     2
10 1 G   474218 474219     88
11 1 C   475466 475467 HP0456 hypothetical protein 53
12 1 C   475645 475646     46
13 1 T   524751 524752 HP0498 sodium- and chloride-dependent transporter 54
14 1 G   579891 579892     76
15 1 A   626216 626217     57
16 1 A   674290 674291 HP0628 hypothetical protein 63
17 1 C   683744 683745 HP0636 hypothetical protein 54
18 1 G   739962 739963 HP0688 hypothetical protein 45
19 1 T   745341 745342 HP0694 hypothetical protein 84
20 1 T   745352 745353     86
21 1 A   745389 745390     95
22 1 T   745429 745430     97
23 2 AG   773423 773424 HP0719 hypothetical protein 55
24 1 C   787709 787710 HP0732 hypothetical protein 62
25 1 G   808800 808801 fliD flagellar capping protein 57
26 1 C   838354 838355 HP0783 hypothetical protein 74
27 1 A   843491 843492     69
28 1 G   861042 861043 HP0807 iron(III) dicitrate transport protein (fecA) 86
29 1 G   888773 888774 HP0836 hypothetical protein 98
30 2 AG   915893 915894 HP0863 hypothetical protein 112
31 1 A   915897 915898 HP0863 hypothetical protein 112
32 1 C   993909 993910 HP0931 hypothetical protein 109
33 1 G   1026924 1026925     63
34 1 T   1057531 1057532     69
35 1 T   1057599 1057600     59
36 1 T   1077873 1077874 HP1014 7-alpha-hydroxysteroid dehydrogenase 83
37 1 G   1207116 1207117 HP1144 hypothetical protein 74
38 1 C   1207608 1207609 HPr04 16S ribosomal RNA 101
39 1 G   1208482 1208483 HPr04 16S ribosomal RNA 1
40 1 C   1208483 1208484 HPr04 16S ribosomal RNA 2
41 1 T   1256328 1256329 HP1186 carbonic anhydrase 72
42 1 C   1259151 1259152     113
43 1 A   1264196 1264197 HP1193 aldo/keto reductase 92
44 1 G   1291618 1291619 HP1216 hypothetical protein 74
45 2 GG   1475694 1475695 HPr06 23S ribosomal RNA 1
46 1 C   1511030 1511031     4
47 1 C   1511162 1511163 HPr04 16S ribosomal RNA 83
48 1 C   1511398 1511399 HPr04 16S ribosomal RNA 11
Total 51         
Short deletion
1 1   A 25622      58
2 1   C 38695   HP0039m conjugal plasmid transfer system protein 62
3 2   YC 129158 129159     1
4 1   C 342188   HP0326 CMP-N-acetylneuraminic acid synthetase 86
5 1   T 426389   HP0413 transposase-like protein, PS3IS 18
6 1   A 463967   HP0445 hypothetical protein 75
7 1   A 593944      81
8 1   G 650897   HP0609 hypothetical protein 73
9 1   A 674221   HP0627 hypothetical protein 47
10 1   T 728119   HP0678 hypothetical protein 75
11 1   G 745422      98
12 1   C 815405   HP0760 phosphodiesterase 41
13 1   C 815420   HP0760 phosphodiesterase 48
14 1   R 1027030      73
15 1   G 1049706      58
16 1   G 1071033   HP1009 site-specific recombinase 77
17 1   T 1077870   HP1014 7-alpha-hydroxysteroid dehydrogenase 87
18 1   G 1081560   HP1018 hypothetical protein 97
19 1   G 1192591   HP1127 hypothetical protein 61
20 1   T 1256382      81
21 1   C 1258321   HP1188 hypothetical protein 71
22 1   T 1264200   HP1193 aldo/keto reductase 91
23 2   NA 1480608 1480609 HP1410 hypothetical protein 1
24 1   A 1480611   HP1410 hypothetical protein 1
25 1   A 1480614   HP1410 hypothetical protein 1
Total 27         
Long deletion
1 42   TGATTATATTTGTAATGGTGCTCRCTTGTTTAAAATGAGYCT 129001 129042 HP0118 hypothetical protein not calculated
2 61   KTCTTTTGGGTTTTGTAAAAATTACCTCCTTAATTTGGTTTTGTTTTGTTTAGACTTTAAC 425976 426036 HP0413 transposase-like protein, PS3IS not calculated
3 14   GGATGGGTGCTTTT 1475703 1475716 HPrrnB23S transposase-like protein, PS3IS not calculated
4 16   NATCCGCGCTTAAGCG 1480568 1480583 HP1410 hypothetical protein not calculated
Total 133