Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers

From: The role of the Cronobacter sakazakii ProP C-terminal coiled coil domain in osmotolerance

Primer name   Primer sequence (5' to 3') Length Characteristics
ESA_02131 F CATCGGCCGACAGGCCAGTCAATGAATGATGC 32 EagI cut site
  R CATTCTAGAGAGTACAACGGAATGCGGGG 29 XbaI cut site
ESA_01706 F CATTCTAGAGTCGGGCGGCTCTTTATCTGG 30 XbaI cut site
  R CATGGATCCTTGACCAGATGACGCAGTCTTTC 32 BamHI cut site
Chimeric-01706 F AATAAGCTTGTGGCTTTTTATGCCGGGCTGC 31 HindIII cut site
  R CAGGCCAGTAATCAGCGCCGCGCCCATGAC 30 3' SOEing overhang
Chimeric-02131CTE F CGCGGCGCTGATTACTGGCCTGACGATGAAAG 32 5' SOEing overhang
  R AATGGATCCTTACTCGTTAATACGAGGATGCTGG 34 BamHI cut site
pUC18 MCS Check F CATTAGCTCACTCATTAGGCACC 23 pUC18 insert check
  R CATTGTAAAACGACGGCCAGTG 22 pUC18 insert check