Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 List of primer used for Amplification and sequencing of dupA gene

From: Association of Intact dupA (dupA1) rather than dupA1 cluster with duodenal ulcer in Indian population

Primer Sequence (5′-3′) PCR cycling condition Amplicon size (bp)
SNT49F ATGTTTCTTGGTTTAGAGGG 94°C 30 sec, 55°C 30 sec and 72°C 2.5 mins 2499
dupAF ATGAGTTCTGTATTAACAGACTTTG 94°C 30 sec, 50°C 30 sec and 72°C 2 mins 1884
SNT49F ATGTTTCTTGGTTTAGAGGG 94°C 30 sec, 55°C 30 sec and 72°C 1 mins 685
dupAF ATGAGTTCTGTATTAACAGACTTTG 94°C 30 sec, 50°C 30 sec and 72°C 1.5 mins 1172
dupA16F ACAATACTGCTAATACAGATG 94°C 30 sec, 55°C 30 sec and 72°C 1 min 947
SNT49_470F ATGATTTTAAATTATGTAGAGACC 94°C 30 sec, 55°C 30 sec and 72°C 40 secs 623
918 F CCTATATCGCTAACGCGCTC 94°C 30 sec, 55°C 30 sec and 72°C 40 secs 791