Skip to main content

Table 2 Primers used for PCR

From: First description of plasmid-mediated quinolone resistance determinants and β-lactamase encoding genes in non-typhoidal Salmonella isolated from humans, one companion animal and food in Romania

Primer Sequence (5′–3′) Target gene Product (bp) References
β-Lactamases
 TEM-F CATTTCCGTGTCGCCCTTAT bla TEM 793 [45]
 TEM-R TCCATAGTTGCCTGACTCCC
 PSE-1-F AATGGCAATCAGCGCTTCCC bla PSE-1 586 [46]
 PSE-1-R GGGGCTTGATGCTCACTACA
 OXA-F ACCAGATTCAACTTTCAA bla OXA 590 [47]
 OXA-R TCTTGGCTTTTATGCTTG
 SHV-F TTATCTCCCTGTTAGCCACC bla SHV 795 [48]
 SHV-R GATTTGCTGATTTCGCTCGG
 CTX-M-F ACCGCGATATCGTTGGT bla CTX-M 550 [49]
 CTX-M-R TTAGTGACCAGAATCAGCGG
Plasmid-mediated quinolone resistance
 qnrA-F ATTTCTCACGCCAGGATTTG qnrA 516 [35]
 qnrA-R GATCGGCAAAGGTTAGGTCA
 qnrB-F GATCGTGAAAGCCAGAAAGG qnrB 476 [35]
 qnrB-R ACGATGCCTGGTAGTTGTCC
 qnrS-F ACGACATTCGTCAACTGCAA qnrS 417 [35]
 qnrS-R TAAATTGGCACCCTGTAGGC
 aac(6′)-Ib-cr-F CCCGCTTTCTCGTAGCA aac(6′)-Ib-cr 544 [50]
 aac(6′)-Ib-cr-R TTAGGCATCACTGCGTCTTC
 qepA-F CGTGTTGCTGGAGTTCTTC qepA 403 [51]
 qepA-R CTGCAGGTACTGCGTCATG