Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers used in this study

From: The O-antigen negative ∆wbaV mutant of Salmonella enterica serovar Enteritidis shows adaptive resistance to antimicrobial peptides and elicits colitis in streptomycin pretreated mouse model

Primers Sequence (5′–3′)
FwKoSEnWbaV TAA GCATTTTTTA TACTATAAACTCGATTTGTATTGATGT TGATAT GTGTAGGCTG GAGCTGCTTC
RwKoSEnWbaV GATTGCCAGTGTATTATATGTATAAGAGTAAAAGGCTAGC
ATAATATATGAATATCCTCCTTAGTT
ConfKoSEnRfV CAACCCCGTCCATACATATTATAGATACAT
FwKoSEnPrt CC ACATCCACCG GTAATTAAAA GCT TCATTTCCCT TCCT C TTCAAT GTGTAGGCTG GAGCTGCTTC
RwKoSEnPrt TAAATTTCTAATTTTTGAGGGGGGGGGATTCCCCTCTAT
GATTCATATGAATATCCTCCTTAGTT
ConfKoSEnPrt GCGAATATCACCATGTACAAACTC
FwKoSEnTyv TTCTT TAATTATGCC CGCTTTCGCG GGCAGAAACA TCATA TAGAA T GTGTAGGCTGGAGCTGCTTC
RwKoSEnTyv TTAACTGAAATAATTGAAGAGGAAGGGAAAATGAAGCTTT
TAATTATATGAATATCCTCCTTAGTT
ConfKoSEnTyv GGAATTCTAACCAACCTCAGTTTCCTC
ConfKt CGGTCCGCCACACCCAGCC
FwCompwbaV GTCGTTAGCCATGGGCCCATTATATATATATCGTTTC
RwCompwbaV GGCGGGCGGTCTAGA CTATGAAAATATTTTTTTTATTACC
FwCompprt GCGCGTTAA CCATGG ATTGTTATTGTGCGCCAGG
RwCompprt GGCGGGCGGTCTAGA TCATTTCCCTTCCTCTTC
FwComptyv GCGCGTTAA CCATGG AATAGAAAGCAATATTCTTATGC
RwComptyv GGCGGGCGGTCTAGA TCATATAGAACTAGTCCAATC