Skip to main content

Table 1 Primers used in this study

From: Description of Campylobacter jejuni Bf, an atypical aero-tolerant strain

Primer Sequence 5′ → 3′ Product size (bp)
mreB F TTCGTACGGCTGGAGATAAG 234
mreB R GTGAAAGAACAGGCGAAGAG  
rrs F AAGGGCCATGATGACTTGACG 207
rrs R AGCGCAACCCACGTATTTAG  
341 F CCTACGGGAGGCACGAG 439
758 R CTACCAGGGTATCTAATCC  
MD16S F ATCTAATGGCTTAACCATTAAAC 856
MD16S R GGACGGTAACTAGTTTAGTATT  
aspA F CCAACTGCAAGATGCTGTACC 625
aspA R GATGGTATTACCGCAAATGAA  
glnA F GCTCAATTCATGGATGGC 722
glnA R GTTCATATGAGCTTATGGAA  
gltA F GTGGCTATCCTATAGAGTGGC 575
gltA R CAGGTATTGGTGCGCTTTGG  
glyA F AGCCTAATTCAGGTTCTCAA 667
glyA R GCGATGGAACGGATAATCACCT  
pgm F TTGGAACTGATGGAGTTCG 1298
pgm R GAAAAAGAAATGAAAAATGTTGTG  
tkt F TGCACCTTTGGGCTTAGC 702
tkt R GCACCTTTGGGTGAAGAAGT  
uncA F AAAGTACAGTGGCACAAGTGG 611
uncA R GCTAGTGATTTAGATGAGGCA