Skip to main content

Table 4 Primers’ sequences and amplification’s conditions used for detection of Salmonella virulence genes

From: Non-Typhoidal Salmonella in poultry meat and diarrhoeic patients: prevalence, antibiogram, virulotyping, molecular detection and sequencing of class I integrons in multidrug resistant strains

Target gene Primers’ sequences 5′–3′ Amplified segment (bp) Primary denaturation Amplification (35 cycles) Final extension References
Secondary denaturation Annealing Extension
pefA TGTTTCCGGGCTTGTGCT 700 94 °C 10 min 94 °C 45 s 55 °C 45 s 72 °C 45 s 72 °C 10 min [4]
CAGGGCATTTGCTGATTCTTCC
hilA CGGAAGCTTATTTGCGCCATGCT GAGGTAG 854 94 °C 10 min 94 °C 45 s 60 °C 45 s 72 °C 45 s 72 °C 10 min [37]
GCATGGATCCCCGCCGGCGAGAT TGTG
sopB TCAGAAGRCGTCTAACCACTC 517 94 °C 5 min 94 °C 30 s 58 °C 30 s 72 °C 30 s 72 °C 7 min [38]
TACCGTCCTCATGCACACTC
stn TTGTGTCGCTATCACTGGCAACC 617 94 °C 10 min 94 °C 45 s 59 °C 45 s 72 °C 45 s 72 °C 10 min [4]
ATTCGTAACCCGCTCTCGTCC