Skip to main content

Table 2 DNA oligonucleotide primers and hydrolysis probes used in this study

From: Lactobacilli with probiotic potential in the prairie vole (Microtus ochrogaster)

Primer 5′-Sequence-3′ References
8F AGAGTTTGATCMTGGCTCAG [65]
1491R ACGGCTACCTTGTTACGACTT [65]
RAPD 272 AGCGGGCCAA [39]
1391R GACGGGCGGTGTGTRCA [78]
GK1053F ATGGCTGTCGTCAGCTCGT Adapted from [79]
GKUNI16STaqCCC VIC-AACGAGCGCAACCC-MGB This study
TaqLacF TGGAAACAGATGCTAATACCG [40, 41]
TaqLacR CGTCCATTGTGGAAGATTCCCT Adapted from [40, 41]
GKLPV16STaq FAM-ACTGAGACACGGCCC-MGB This study