Skip to main content

Table 1 Primers and amplification conditions used for PCR

From: Oxidative stress due to Mycobacterium avium subspecies paratuberculosis (MAP) infection upregulates selenium-dependent GPx activity

Primer Oligonucleotide sequence (5′–3′) Gene Amplification conditions Product size (bp) References
P90, P91 GTTCGGGGCCGTCGCTTAGG, GAGGTCGATCGCCCACGTGA IS900 95 °C for 5 min, then 34 cycles of 95 °C for 1 min, 58 °C for 1.5 min, 72 °C for 1.5 min. Final extension of 10 min at 72 °C 398 Naser et al. [3]
AV1, AV2 ATGTGGTTGCTGTGTTGGATGG, CCGCCGCAATCAACTCCAG IS900 95 °C for 5 min, then 34 cycles of 95 °C for 1 min, 58 °C for 1.5 min, 72 °C for 1.5 min. Final extension of 10 min at 72 °C 298 Naser et al. [3]