Skip to main content

Table 2 Primers used in this study

From: Helicobacter pylori plasticity region genes are associated with the gastroduodenal diseases manifestation in India

Primer Sequence (5′-3′) Amplicon (bp) Reference
jhp0940F GAAATGTCCTATACCAATGG 600 [22]
[22]
jhp0940R CCTAAGTAGTGCATCAAGG
jhp0945F ACTCCAGCCAGTATTGTAAA 246 [22]
[22]
jhp0945R TTCTTGCGAGTTAGGATTGG
jhp0947F GATAATCCTACGCAGAAC 650 [22]
[22]
jhp0947R GCTAAAGTCATTTGGCTGTC
jhp0949F ATAGGAGTGGGTGCTTACTT 788 [22]
[22]
jhp0949R AGCAACAACAAAGGCATGTA
ureBF CGTCCGGCAATAGCTGCCATAGT 480 [34]
[34]
ureBR GTAGGTCCTGCTACTGAAGCCTTA
CagA5CF GTTGATAACGCTGTCGCTTCA 350 [25]
[25]
CagA3CR GGGTTGTATGATATTTTCCATAA
Lunil1 ACATTTTGGCTAAATAAACGCTG 550 [25]
[25]
R5280 CCAACGTGCGTAAAAGGGAATTAG
vacAsF ATGGAAATACAACAAACACAC s1-259/s2-286 [35]
[35]
vacAsR CTGCTTGAATGCGCCAAAC
vacAmF CAATCTGTCCAATCAAGCGAG m1-567/m2-642 [35]
[35]
vacAmR GCGTCAAAATAATTCCAAGG