Skip to main content

Table 1 Sequences of primers used for zot gene cloning

From: Examination of the effects of Campylobacter concisus zonula occludens toxin on intestinal epithelial cells and macrophages

Primers Sequence (5′–3′) Reference
F_pETB2_P14UCO-S1 CACATGCCATGG-CG ATGTTAAGTTTGATTATAGGTCCG This study
R_pETB2_P14UCO-S1 CAATAACTCGAG^-CTTGAGAGTAGGAAGCATAGG
  1. Extra base pairs on the 5′ end of the primer are underlined and denote leader sequences, sequences in italics denote restriction enzyme sites for NcoI, sequences in italics and the symbol^ denote restriction enzyme site for XhoI, sequences in bold denote zot gene sequences