Skip to main content

Table 1 Primer sets used for amplification of class I and II integrons

From: Antimicrobial resistance and integron gene cassette arrays in commensal Escherichia coli from human and animal sources in IRI

Gene target Sequence (5′–3′) References
Class I integron variable region GGCATCCAAGCAAG Levesque et al. [9]
Class I integron variable region AAGCAGACTTGACCTGA Levesque et al. [9]
Class II integron variable region GATGCCATCGCAAGTACGAG White et al. [10]
Class II integron variable region CGGGATCCCGGACGGCATGCACGATTTGTA White et al. [10]