Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for DNA sequencing of H. pylori cagA and vacA in this study

From: Differences in amino acid frequency in CagA and VacA sequences of Helicobacter pylori distinguish gastric cancer from gastric MALT lymphoma

Gene Primer Sequence (5′–3′) References
cagA Luni 1 ACATTTTGGCTAAATAAACACTG [39]
R5280 GTTGCACGCATTTTCCCTTGATC [39]
L2(+) AAGGAGAAACAATGACTAACGAAACTATTG [40]
L2(−) TCCTTTAAGATTTTTGGAAACCACCTTTTG [40]
hp552−R2 CTCTTACTCACCCTTGTATCCTCGCATA In this study
hp552−R1 GCCTGGATCGCTCAAACTTGGCATGC In this study
cagA−R2 GGGTGTTGATTTTAGACGGATC In this study
cagA−F9 TCGTTCAAGTTTTCCACCAAGTTGA In this study
cagA−F11 CAATCAAGAGGCTAGTAAGGAAG In this study
cagA−F6 CTCTCAAAGATTATGGGAAAAAA In this study
cagA−F10 ACAATAACGTTCTATCTTCTGTGCT In this study
cagA−F8 AAAGATCCGTCTAAAATCAACACCC In this study
TF ACCCTAGTCGGTAATG [20]
TR TATCAGAAGCTAAAAC [20]
OMF AGCAAAAAGCGACCTTGAAA [20]
OMR ATTCACGAGCTTGAGCCACT [20]
vacA vacAcysS−F2 GAATTTCAATGAAGAAGACTTGTT In this study
vacA−R4 GCGGTGTGTTTGTTGTATTTCCAT In this study
VA1−F ATGGAAATACAACAAACACAC [22]
VAG−R GCGTCAAAATAATTCCAAGGC [25]
VAG−F CAATCTTGTCCAATCAAGCGAG [25]
VA3−F GGTCAAAATGCGGTCATGG [22]
vacAfecE−R2 CTTATTGTTACTGGATGAGCCTA In this study