Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 The primers and reactions condition applied to detect enteric pathogens in this study

From: Case–control study of diarrheal disease etiology in individuals over 5 years in southwest China

Enteric pathogens Target gene Primer (5′–3′) Amplicon sizes (bp) Remarks Source
EPEC eae CCACGGTTTATCAAACTGATAACG 105 Each stool specimen was inoculated to MAC media to culture DEC at 37 °C for 18 h, And then ten putative DEC colonies were selected to mix with 150 μL water to extract DNA at 100 °C for 10 min, and then the 20 μL volume of qPCR system is composed of 10 μL master mix (Takara Bio Inc, Shiga, Japan), 1 μL forward primer (10 μmol), 1 μL reverse primer (10 μmol), 1 μL DNA template and 7 μL H2O. The cycling conditions for each subtype DEC was 95 °C for 5 min, 40 cycles of 95 °C for 5 s, 60 °C for 30 s. The fluorescence recorded was at the annealing stage [20, 21]
EHEC stx1 ACTTCTCGACTGCAAAGACGTATG 132
ACAAATTATCCCCTGAGCCACTATC
stx2 CCACATCGGTGTCTGTTATTAACC 93
GGTCAAAACGCGCCTGATAG
ETEC elt TTCCCACCGGATCACCAA 62
CAACCTTGTGGTGCATGATGA
estA CCTTTCGCTCAGGATGCTAAAC 128
CAGTAATTGCTACTATTCATGCTTTCAG
estB CTTTCCCCTCTTTTAGTCAGTCAACT 137
GCAGTAAAATGTGTTGTTCATATTTTCTG
EAEC aggR CAGCGATACATTAAGACGCCTAAAG 116
CGTCAGCATCAGCTACAATTATTCC
EIEC ipaH ACCATGCTCGCAGAGAAACT 175
TCAGTACAGCATGCCATGGT
RVA VP6 GACGGVGCRACTACATGGT 382 RVA, NoV GI, NoV GII, SaV and As were RNA viruses, complementary DNA (cDNA) was synthesized using a random primer (Takara Bio Inc, Shiga, Japan) at 55 °C for 1.5 h, followed by 100 °C for 10 min, and holding at 4 °C. The reaction condition of RVA was 94 °C for 5 min, followed by 40 cycles at 94 °C for 1 min, 42 °C for 1 min, 72 °C for 1 min, and with final extension at 72 °C for 10 min. Multiplex RT-PCR was used to detect the presence of NoV GI, NoV GII, and SaV, the thermal profile consisted of 94 °C for 5 min, 40 cycles of 94 °C for 70 s, 49 °C for 70 s, and 72 °C for 1 min, followed by 72 °C for 10 min. The thermal profile of As was 94 °C for 5 min, 40 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, followed by 72 °C for 10 min [22]
GTCCAATTCATNCCTGGTGG
NoV GI
NoV GII
SaV
Polymerase TGACGATTTCATCATCACCATA 331/319 [23]
TGACGATTTCATCATCCCCGTA
GATTACTCCAGGTGGGACTCCAC
GATTACTCCAGGTGGGACTCAAC
GATTACTCCAGGTGGGATTCAAC
GATTACTCCAGGTGGGATTCCAC
As Capsid CAACTCAGGAAACAGGGTGT 449 [24]
TCAGATGCATTGTCATTGGT
Ad Hexon TTCCCCATGGCICAYAACAC 482 The thermal profile was 94 °C for 5 min, 40 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min, followed by 72 °C for 10 min [25]
CCCTGGTAKCCRATRTTGTA
Blastocistis hominis SSU-rRNA CGAATGGCTCATTATATCAGTT 260 The thermal profile was 94 °C for 5 min, 40 cycles of 94 °C for 30 s, 53 °C for 30 s, and 72 °C for 1 min, followed by 72 °C for 10 min [26]
TCTTCGTTACCCGTTACTGC
Cryptosporidium spp. 18S-rRNA TTCTAGAGCTAATACATGCG   The primary cycle consisted of 94 °C for 5 min, 35 cycles of 94 °C for 50 s, 55 °C for 1 min and 72 °C for 90 s, followed by 72 °C for 10 min, the annealing step for a second reaction was 58 °C [27]
CCCATTTCCTTCGAAACAGGA  
GGAAGGGTTGTATTTATTAGATAAAG 840
CTCATAAGGTGCTGAAGGAGTA
Giardia lamblia Tim AAATIATGCCTGCTCGTCG   The thermal profile of first round was 94 °C for 1 min, 53 °C for 1 min, and 72 °C for 1 min, followed by 72 °C for 10 min. A second reaction was carried out similarly [28]
CAAACCTTITCCGCAAACC  
CCCTTCATCGGIGGTAACTT 530
GTGGCCACCACICCCGTGCC
  1. DEC is composed of EAEC, EPEC, EIEC, ETEC and EHEC in this study, the judging standard of subtypes of DEC according to qPCR was: EPEC: eae+; EAEC: aggR+; EIEC: ipaH+; EHEC: eae+, and (stx1+; and/or stx2+); ETEC: hlt+, and/or estA, and/or estB+