Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Detailed description of pathogen-specific polymerase chain reaction primers for their specific detection in stool

From: Multiple etiologies of infectious diarrhea and concurrent infections in a pediatric outpatient-based screening study in Odisha, India

Pathogen Target gene Primer name Primer sequence (5′ to 3′) Tm (°C) Size (bp) References
Escherichia coli
EAEC EAEC pCVD432 EAEC_pCVD432_F_11 CTGGCGAAAGACTGTATCAT 51 630 [23]
   EAEC_pCVD432_R_12 AAATGTATAGAAATCCGCTGTT    
EPEC EPEC bfpA EPEC_bfpA_F_9 TTCTTGGTGCTTGCGTGTCTTTT 53 367 [23]
   EPEC_bfpA_F_10 TTTTGTTTGTTGTATCTTTGTAA    
EPEC EPEC eae gene EPEC_eaeA_F GACCCGGCACAAGCATAAGC 59 384 [24]
   EPEC_eaeA_R CCACCTGCAGCAACAAGAGG    
STEC EHEC vt1 EHEC_vt2_R_7 ACCGTTTTTCAGATTTT(G/A)CACATA 52 298 [23]
   EHEC_vt2_R_8 TACACAGGAGCAGTTTCAGACAGT    
STEC EHEC hlyA gene EHEC_hlyA_F GCATCATCAAGCGTACGTTCC 57 534 [24]
   EHEC_hlyA_R AATGAGCCAAGCTGGTTAAGCT 54 180  
STEC stx1 E. coli_stx1F ATAAATCGCCATTCGTTGACTAC    [24]
   E. coli_stx1R GGCACTGTCTGAAACTGCTCC    
STEC stx2 E. coli_stx2F GGCACTGTCTGAAACTGCTCC 56 255 [24]
   E. coli_stx2R TCGCCAGTTATCTGACATTCTG    
STEC rfbE 157:H7 O157_F CGGACATCCATGTGATATGG 52 259 [24]
   O157_R TTGCCTATGTACAGCTAATCC    
STEC H7 FLIC H7_FLIC-R_13 GCGCTGTCGAGTTCTATCGAGC 59 625 [23]
   H7_FLIC-R_14 CAACGGTGACTTATCGCCATTCC    
STEC O111 rfb region O111_F TAGAGAAATTATCAAGTTAGTTCC 49 406 [24]
   O111_R ATAGTTATGAACATCTTGTTTAGC    
Shigella spp.
  ShET 1 Shigella_1A_F CAG CGT CTT TCA GCG ACA GTG TTT 57 530 [8]
   Shigella_1A_R AGC ATG ATA CTC AAC AGC CAG ACC    
   Shigella_1B_F ATA CTG GCT CCT GTC ATT CAC GGT    
   Shigella_1B_R GGA AGT GAC AGG GCA TTT GTG GAT    
Salmonella spp.
  Sdf I Salmonella_sdf1_FW TGT GTT TTA TCT GAT GCA AGA GG 53 304 [25, 26]
   Salmonella_sdf1_RW TGA ACT ACG TTC GTT CTT CTG G    
Vibrio cholera
  Vc Vibrio_Vc_FW GTTCGCGCTGGTGAAGGTTCA 57 192 [27]
   Vibrio_Vc_RW TGGCATACCAGAGTCTTTCTGTG    
Cryptosporidium spp.
  18 s SSU rRNA locus 18 s Morgan F AGTGACAAGAAATAACAATACAGG 60 298 [28]
  18 s Morgan R CCTGCTTTAAGCACTCTAATTTTC    
Giardia spp.
  gdh gene GDHeF TCAAGCTYAAYGCYGGYTTGCGT 57 432 [29]
   GDHiF CAGTACAACTCYGCTCTCGG    
   GDHiR GTTRTCCTTGCACATCTCC