Skip to main content

Advertisement

Table 1 Primer sequences and the PCR conditions used in this study

From: Prevalence, virulence potential, and pulsed-field gel electrophoresis profiling of Shiga toxin-producing Escherichia coli strains from cattle

Target gene Nucleotide sequences (5′–3′) PCR conditions Amplicon size (bp) References
Denaturation Annealing Extension Cycle
stx 1 CAGTTAATGTGGTGGCGAAGG 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
25 348 [58]
CACCAGACAATGTAACCGCTG
stx 2 ATCCTATTCCCGGGAGTTTACG 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
25 584 [58]
GCGTCATCGTATACACAGGAGC
stx 1c TTTTCACATGTTACCTTTCCT 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
30 498 [42]
CATAGAAGGAAACTCATTAGG
stx 1d CTTTTCAGTTAATGCGATTGCT 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
30 192 [42]
AACCCCATGATATCGACTGC
stx 2a GCGATACTGRGBACTGTGGCC 94 °C,
50 s
65 °C,
40 s
72 °C,
30 s
25 349 [59]
CCGKCAACCTTCACTGTAAATGTG
stx 2c GCGGTTTTATTTGCATTAGT 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
30 124 [42]
AGTACTCTTTTCCGGCCACT
stx 2d GGTAAAATTGAGTTCTCTAAGTAT 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
30 175 [42]
CAGCAAATCCTGAACCTGACG
stx 2e ATGAAGAAGATGTTTATAGCG 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
30 267 [42]
TCAGTTAAACTTCACCTGGGC
stx 2f AGATTGGGCGTCATTCACTGGTTG 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
30 428 [42]
TACTTTAATGGCCGCCCTGTCTCC
stx 2g GTTATATTTCTGTGGATATC 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
30 573 [42]
GAATAACCGCTACAGTA
eae ATTACTGAGATTAAGGCTGAT 94 °C,
20 s
58 °C,
20 s
72 °C,
90 s
35 682 [4]
ATTTATTTGCAGCCCCCCAT
tir CATTACCTTCACAAACCGAC 94 °C,
40 s
57 °C,
60 s
72 °C,
75 s
30 1550 [60]
CCCCGTTAATCCTCCCAT
esp B GCCGTTTTTGAGAGCCAGAAT 94 °C,
40 s
63 °C,
45 s
72 °C,
60 s
30 633 [60]
ATCATCCTGCGCTCTGCGAAC
etp D CGTCAGGAGGATGTTCAG 94 °C,
30 s
54 °C,
60 s
72 °C,
90 s
30 1062 [61]
CGACTGCACCTGTTCCTGATTA
ehx A GTTTATTCTGGGGCAGGCTC 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
25 166 [58]
CTTCACGTCACCATACATAT
Kat P CTTCCTGTTCTGATTCTTCTGG 94 °C,
30 s
58 °C,
60 s
72 °C,
150 s
30 2125 [27]
AACTTATTTCTCGCATCATCC
esp P AAACAGCAGGCACTTGAACG 94 °C,
30 s
58 °C,
60 s
72 °C,
150 s
30 1830 [25]
GGAGTCGTCAGTCAGTAGAT
iha CTGGCGGAGGCTCTGAGATCA 94 °C,
60 s
57 °C,
60 s
72 °C,
120 s
30 827 [62]
TCCTTAAGCTCCCGCGGCTGA
sub A CGGCTTATCATCCTGTCAGC 94 °C,
45 s
57 °C,
60 s
74 °C,
60 s
30 233 [63]
TATAGCTGTTGCTTCTGACG
stc E GGCTCCGGAGGTGGGGGAAT 94 °C,
30 s
60 °C,
60 s
72 °C,
15 s
30 399 [53]
GAAGCCGGTGGAGGAACGGC
saa CGTGATGAACAGGCTATTGC 94 °C,
60 s
56 °C,
60 s
72 °C,
60 s
30 119 [56]
ATGGACATGCCTGTGGCAAC
tetA GCTACATCCTGCTTGCCTTC 95 °C,
60 s
58 °C,
60 s
72 °C,
60 s
30 210 [64]
CATAGATCGCCGTGAAGAG
tetB TTGGTTAGGGGCAAGTTTTG 95 °C,
60 s
56 °C,
60 s
72 °C,
60 s
30 659 [64]
GTAATGGGCCAATAACACCG
tetC CTTGAGAGCCTTCAACCCAG 95 °C,
60 s
58 °C,
60 s
72 °C,
60 s
30 418 [64]
ATGGTCGTCATCTACCTGCC
tetD AAACCATTACGGCATTCTGC 95 °C,
60 s
60 °C,
60 s
72 °C,
60 s
30 787 [64]
GACCGGATACACCATCCATC
tetE AAACCACATCCTCCATACGC 95 °C,
60 s
58 °C,
60 s
72 °C,
60 s
30 278 [64]
AAATAGGCCACAACCGTCAG
tetG GCTCGGTGGTATCTCTGCTC 95 °C,
60 s
60 °C,
60 s
72 °C,
60 s
30 468 [64]
AGCAACAGAATCGGGAACAC
ampC CCCCGCTTATAGAGCAACAA 94 °C,
60 s
61 °C,
120 s
72 °C,
180 s
35 634 [65]
TCAATGGTCGACTTCACACC
catA1 AGTTGCTCAATGTACCTATAACC 95 °C,
60 s
57 °C,
70 s
72 °C,
120 s
32 547 [64]
TTGTAATTCATTAAGCATTCTGCC
cmlA CCGCCACGGTGTTGTTGTTATC 95 °C,
60 s
57 °C,
70 s
72 °C,
120 s
32 698 [64]
CACCTTGCCTGCCCATCATTAG
qnr TATCTCCCTGTCGTTCCAG 94 °C,
30 s
52 °C,
30 s
72 °C,
30 s
30 399 [66]
AGAACTCGCCGATCAATG
bla CMY TGGCCAGAACTGACAGGCAAA 94 °C,
60 s
49 °C,
90 s
72 °C,
60 s
35 462 [67]
TTTCTCCTGAACGTGGCTGGC
bla OXA TATCTACAGCAGCGCCAGTG 94 °C,
60 s
62 °C,
120 s
72 °C,
60 s
31 199 [65]
CGCATCAAATGCCATAAGTG
bla TEM TACGATACGGGAGGGCTTAC 94 °C,
60 s
62 °C,
60 s
72 °C,
60 s
30 717 [68]
TTCCTGTTTTTGCTCACCCA