Skip to main content

Table 2 PCR primers for screening virulence and antibiotic resistance genes in bacteria isolated from the gut of healthy children in Bangladesh

From: Multi-drug resistant pathogenic bacteria in the gut of young children in Bangladesh

Primer Primer sequence (5′ → 3′) Target Amplicon size (bp) References
Stx2f GGCACTGTCTGAAACTGCTCC stx 2 225 [12]
Stx2r TCGCCAGTTATCTGACATTCTG
eae1 CTGAACGGCGATTACGCGAA eae 917 [12]
eae2 CCAGACGATACGATCCAG
INT-1U GTTCGGTCAAGGTTCTG intl1 923 [16]
INT-1D GCCAACTTTCAGCACATG
mphA(F) GTGAGGAGGAGCTTCGCGAG mphA 403 [13]
mphA(R) TGCCGCAGGACTCGGAGGTC
ereB(F) TTGGAGATACCCAGATTGTAG ereB 537 [13]
ereB(R) GAGCCATAGCTTCAACGC
ermB(F) GAAAAAGTACTCAACCAAATA ermB 639 [13]
ermB(R) AATTTAAGTACCGTTACT
INT1 GCTGGATAGGTTAAGGGCGG Sxt-integrase 592 [17]
INT2 CTCTATGGGCACTGTCCACATTG
TEM(F) ATTCTTGAAGACGAAAGGGC bla TEM 1150 [14]
TEM(R) ACGCTCAGTGGAACGAAAAC
OXA-F ACACAATACATATCAACTTCGC Bla OXA 813 [14]
OXA-R AGTGTGTTTAGAATGGTGATC
SHV-F CACTCAAGGATGTATTGTG bla SHV 885 [14]
SHV-R TTAGCGTTGCCAGTGCTCG
CMY-9(F) TCAGCGAGCAGACCCTGTTC bla CMY-9 874 [15]
CMY-9(R) CTGGCCGGGATGGGATAGTT
CTX-M1(F) AACCGTCACGCTGTTGTTAG bla CTX-M1 766 [15]
CTX-M1(R) TTGAGGCTGGGTGAAGTAAG
CTX-M2(F) GGCGTTGCGCTGATTAACAC bla CTX-M2 486 [15]
CTX-M2(R) TTGCCCTTAAGCCACGTCAC
TetA (F) GTAATTCTGAGCACTGTCGC tetA 937 [14]
TetA (R) CTGCCTGGACAACATTGCTT
TetB (F) CTCAGTATTCCAAGCCTTTG tetB 416 [14]
TetB (R) CTAAGCACTTGTCTCCTGTT
TetD (F) ATTACACTGCTGGACGCGAT tetD 1104 [14]
TetD (R) CTGATCAGCAGACAGATTGC