Skip to main content

Table 1 Sequence of the oligonucleotides used in the study

From: Development and evaluation of a PCR assay for rapid detection of azithromycin resistant Campylobacter isolated from diarrhoeal patients in Kolkata, India

Used for Primer Primer sequence (5′ to 3′) Amplicon size (bp) Reference
MAMA PCR 23s rRNA-Campy-1912F AGTAAACGGCGGCCGTAAC   This study
23s rRNA-Campy-2074 N-Rev GTAAAGGTCCACGGGGTCATT 183 This study
23s rRNA-Campy-2075 R GTAAAGGTCCACGGGGTCAC 183 This study
Sequencing F2-Campy-23S AATTGATGGGGTTAGCATTAGC 552 21
2420R-Campy-23S AGAACCACCGGATCACTAAGA 10