Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Sequence of the primers and probes

From: Detection of enterotoxigenic Bacteroides fragilis in patients with ulcerative colitis

Gene name Primer F
Primer R (5′–3′)
Probe (5′–3′) Product size
16S rRNA TGGACTGCAACTGACACTGA
GCCGCTTACTGTATATCGCA
FAM-TCCTGTTTGATACCCACACTTTCGAGC-BHQ1 115
bft TGAAGTTAGTGCCCAGATGC
CAGTAAAGCCTTCCAGTCC
FAM-AAGTGGCGACGCCAAAGAGG-BHQ1 150