Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Primers used for detection of selected antibiotic resistance genes

From: Assessment of antibiotic susceptibility in Lactobacillus isolates from chickens

Determining resistance to Target gene Primer sequence (5′–3′) Amplicon size (bp) Annealing temperature (°C) Reference
Tetracyclines tetM GTG GAC AAA GGT ACA ACG AG
CGG TAA AGT TCG TCA CAC AC
406 60 [14]
tetK GAT CAA TTG TAG CTT TAG GTG AAG G
TTT TGT TGA TTT ACC AGG TAC CAT T
155 60
tetL TGG TGG AAT GAT AGC CCA TT
CAG GAA TGA CAG CAC GCT AA
229 60
tetO AAC TTA GGC ATT CTG GCT CAC
TCC CAC TGT TCC ATA TCG TCA
515 60
tetQ TTA TAC TTC CTC CGG CAT CG
ATC GGT TCG AGA ATG TCC AC
904 55 [64]
tetW GAG AGC CTG CTA TAT GCC AGC
GGG CGT ATC CAC AAT GTT AAC
168 64 [65]
Macrolides ermA CCC GAA AAA TAC GCA AAA TTT CAT
CCC TGT TTA CCC ATT TAT AAA CG
590 60 [14]
ermB TGG TAT TCC AAA TGC GTA ATG
CTG TGG TAT GGC GGG TAA GT
745 60
ermC AAT CGT CAA TTC CTG CAT GT
TAATCGTGGAATACGGGTTTG
299 58 [31]
ermT TAT TAT TGA GAT TGG TTC AGG G
GGA TGA AAG TAT TCT CTA GGG ATT T
395 55 [33]
msrA/B GCA AAT GGT GTA GGT AAG ACA ACT
ATC ATG TGA TGT AAA CAA AAT
399 54 [66]
msrC AAG GAA TCC TTC TCT CTC CG
GTA AAC AAA ATC GTT CCC G
343 55 [67]
mefA/E CAA TAT GGG CAG GGC AAG
AAG CTG TTC CAA TGC TAC GC
317 60 [14]
lnuA GGT GGC TGG GGG GTA GAT GTA TTA ACT GG
GCT TCT TTT GAA ATA CAT GGT ATT TTT CGA TC
323 61 [32]
Aminoglicosides aac(6’)-Ie-aph(2)-Ia CAG AGC CTT GGG AAG ATG AAG
CCT CGT GTA ATT CAT GTT CTG GC
348 57 [15]
aph3IIIa GGC TAA AAT GAG AAT ATC ACC GG
CTT TAA AAA ATC ATA CAG CTC GCG
523
ant(4’)-Ia CAA ACT GCT AAA TCG GTA GAA GCC
GGA AAG TTG ACC AGA CAT TAC GAA CT
294
aph(2)-Ic CCA CAA TGA TAA TGA CTC AGT TCC C
CCA CAG CTT CCG ATA GCA AGA G
444
aph(2)-Id GTG GTT TTT ACA GGA ATG CCA TC
CCC TCT TCA TAC CAA TCC ATA TAA CC
641
ant(6)-Ia CGG GAG AAT GGG AGA CTT TG
CTG TGG CTC CAC AAT CTG AT
563 56 [54]
aac(6’)-Ii TGGCCGGAAGAATATGGAGA
GCATTTGGTAAGACACCTACG
410 55
aadA ATC CTT CGG CGC GAT TTT G
GCA GCG CAA TGA CAT TCT TG
282 55 [47]
aadE ATG GAA TTA TTC CCA CCT GA
TCA AAA CCC CTA TTA AAG CC
1100 51 [51]
Chloramphenicol cat TAA GGT TAT TGG GAT AAG TTA
GCA TGR TAA CCA TCA CAW AC
~300 54 [18]
Tiamulin cfr TGA AGT ATA AAG CAG GTT GGG AGT CA
ACC ATA TAA TTG ACC ACA AGC AGC
746 58 [68]
lsaE TGT CAA ATG GTG AGC AAA CG
TGT AAA ACG GCT TCC TGA TG
496 54 [69]
lsaC GGC TAT GTA AAA CCT GTA TTT G
ACT GAC AAT TTT TCT TCC GT
429 50 [70]
vgaA AGT GGT GGT GAA GTA ACA CG
CTC TTG TTC TAA TTC TTC CG
1287 53 [70]
vgaAv CTC CGT GTT GAA GAT GTT TCG
GGA TTC AAA CGC CTC TAT AGC C
459 56 [71]
Penicillins blaZ ACT TCA ACA CCT GCT GCT TTC
TAG GTT CAG ATT GGC CCT TAG
240 60 [72]
mecA AGT TCT GCA GTA CCG GAT TTG C
AAA ATC GAT GGT AAA GGT TGG C
533 55 [73]
pbp5 AAC AAA ATG ACA AAC GGG
TAT CCT TGG TTA TCA GGG
779 52 [74]
Many antibiotics acrA CTC TCA GGC AGC TTA GCC CTA A
TGC AGA GGT TCA GTT TTG ACT GTT
107 58 [58]
mdeA CTT TCA GGT TAC CTT GTT GAA TAT TTA AAC
ATC AAT AGG TAC TTT AAT TGT AGT TCC AAC
180 56 [75]
norA TTT GTT TTC AGT GTC AGA ATT TAT GTT TG
GGC TTG GTG AAA TAT CAG CTA TTA AAC
140 56
mepA ATG GTA TAG GTT TCT TGT TTA CTG GTA TG
AAT GAT AAT TGC ACC TTG TAA AAT GGC
150 57