Skip to main content

Table 5 Gene primers used in this study

From: Virulence gene profiles and molecular genetic characteristics of diarrheagenic Escherichia coli from a hospital in western China

Gene Primer sequence (5′-3′) PCR product (bp) References
alr F: CTGGAAGAGGCTAGCCTGGACGAG
R: AAAATCGCCACCGGTGGAGCGATC
369 [90]
pic F: GGGTATTGTCCGTTCCGAT
R: ACAACGATACCGTCTCCCG
1176 [93]
astA F: CCATCAACACAGTATATCCGA
R: GGTCGCGAGTGACGGCTTTGT
111 [73]
aggR F: ACGCAGAGTTGCCTGATAAAG
R: AATACAGAATCGTCAGCATCAGC
400 [94]
stx1 F: CGATGTTACGGTTTGTTACTGTGACAGC
R: AATGCCACGCTTCCCAGAATTG
244 [94]
stx2 F: GTTTTGACCATCTTCGTCTGATTATTGAG
R: AGCGTAAGGCTTCTGCTGTGAC
324 [94]
eae F: TGAGCGGCTGGCATGAGTCATAC
R: TCGATCCCCATCGTCACCAGAGG
241 [95]
bfp F: GACACCTCATTGCTGAAGTCG
R: CCAGAACACCTCCGTTATGC
324 [94]
ipaH F: GTTCCTTGACCGCCTTTCCGATACCGTC
R: AAAATCGCCACCGGTGGAGCGATC
619 [7]
est F: ATTTTTCTTTCTGTATTGTCTT
R: CACCCGGTACAGGCAGGATT
190 [96]
elt F: GGCGACAGATTATACCGTGC
R: CGGTCTCTATATTCCCTGTT
450 [96]
daaD F: TGAACGGGAGTATAAGGAAGATG
R: GTCCGCCATCACATCAAAA
444 [97]
daaE F: GAACGTTGGTTAATGTGGGGTAA
R: TATTCACCGGTCGGTTATCAGT
542 [8]
fimC F: GGGTAGAAAATGCCGATGGTG
R: CGTCATTTTGGGGGTAAGTG
477 [98]
fimH F: CGAGTTATTACCCTGTTTGCTG
R: ACGCCAATAATCGATTGCAC
878 [73]
aggA F: GCTAACGCTGCGTTAGAAAGACC
R: GGAGTATCATTCTATATTCGCC
421 [73]
aafA F: ATGTATTTTTAGAGGTTGAC
R: TATTATATTGTCACAAGCTC
518 [20]
agg3A F: GTATCATTGCGAGTCTGGTATTCAG
R: GGGCTGTTATAGAGTAACTTCCAG
462 [73]
agg4A F: TGAGTTGTGGGGCTAYCTGGACACC
R: ATAAGCCGCCAAATAAGC
169 [74]
lpfA F: AGGCGGTGCATTCACTCTGGCATCT
R: CCGCGTCGATAGCGGTATAGGCAGA
446 [99]
sfa F: CTCCGGAGAACTGGGTGCATCTTAC
R: CGGAGGAGTAATTACAAACCTGGCA
408 [73]
pap F: GACGGCTGTACTGCAGGGTGTGGCG
R: ATATCCTTTCTGCAGGGATGCAATA
328 [73]
irp2 F: AAGGATTCGCTGTTACCGGAC
R: TCGTCGGGCAGCGTTTCTTCT
264 [100]
fyuA F: TGATTAACCCCGCGACGGGAA
R: CGCAGTAGGCACGATGTTGTA
785 [34]
escJ F: CACTAAGCTCGATATATAGAACCC
R: GTCAATGTTGATGTCGTATCTAAG
824 [80]
escN F: CGCCTTTTACAAGATAGAAC
R: CATCAAGAATAGAGCGGAC
854 [101]
escV F: GATGACATCATGAATAAACTC
R: GCCTTCATATCTGGTAGAC
2128 [80]
espP F: AAACAGCAGGCACTTGAACG
R: GGAGTCGTCAGTCAGTAGAT
1830 [93]
nleB F: GGAAGTTTGTTTACAGAGACG
R: AAAATGCCGCTTGATACC
297 [43]
nleE F: GTATAACCAGAGGAGTAGC
R: GATCTTACAACAAATGTCC
260 [43]
ent/espL2 F: GAATAACAATCACTCCTCACC
R: TTACAGTGCCCGATTACG
233 [43]
cnf1 F: GGCGACAAATGCAGTATTGCTTGG
F: GACGTTGGTTGCGGTAATTTTGGG
552 [93]
cnf2 F: GTGAGGCTCAACGAGATTATGCACTG
R: CCACGCTTCTTCTTCAGTTGTTCCTC
839 [93]
cdt-I F: CAATAGTCGCCCACAGGA
R: ATAATCAAGAACACCACCAC
412 [102]
cdt-II F: GAAAGTAAATGGAATATAAATGTCCG
R: TTTGTGTTGCCGCCGCTGGTGAAA
556 [102]
invE F:CGATCAAGAATCCCTAACAGAAGAATCAC
R: CGATAGATGGCGAGAAATTATATCCCG
766 [94]
hlyA F: GCATCATCAAGCGTACGTTCC
R: AATGAGCCAAGCTGGTTAAGCT
533 [100]
pet F: TTTCCAGCACTTCCTGTTCC
R: ATTTCCAACGTCTACGCCAT
297 [103]
sat F: GCAGCAAATATTGATATATCA
R: GTTGTTGACCTCAGCAAGGAA
2913 [80]
subAB F: TATGGCTTCCCTCATTGCC
R: TATAGCTGTTGCTTCTGACG
556 [104]