Skip to main content

Table 3 The primers used in this study

From: Toxigenic and non-toxigenic patterns I, II and III and biofilm-forming ability in Bacteroides fragilis strains isolated from patients diagnosed with colorectal cancer

Target regionSequence 5′ to 3′Amplicon size (bp)
B fragilis groupF: ATAGCCTTTCGAAAGRAAGAT
R: CCAGTATCAACTGCAATTTTA
495
B fragilisF: TCRGGAAGAAAGCTTGCT
R: CATCCTTTACCGGAATCCT
163
All bft geneF: GGATACATCAGCTGGGTTGTAG
R: GCGAACTCGGTTTATGCAGT
296
bft-1F: TCTTTTGAATTATCCGTATGCTC
R: CTTGGGATAATAAAATCTTAGGGATG
169
bft-2F: ATTTTTAGCGATTCTATACATGTTCTC
R: GGGCATATATTGGGTGCTAGG
114
bft-3F: TGGATCATCCGCATGGTTA
R: TTTGGGCATATCTTGGCTCA
148
Flanking regionF: TTCAACCTGATCGATCCGGAAGATCCG
R: GCTGGTAGACTACCTGAGTAAGGAGTC
1600
BFT qRT-PCRF: AAGGGCTGGATGGCTTTACT
R: GGGATACATCAGCTGGGTTG
16S qRT-PCRF: CAGTCTTGAGTACAGTAGAGGTGG
R: GTGGACTACCAGGGTATCTAATCC