Skip to main content

Table 1 Primers and probes for ARMS-PCR and Sanger sequencing

From: Evaluation of multiplex ARMS-PCR for detection of Helicobacter pylori mutations conferring resistance to clarithromycin and levofloxacin

Methods Gene Primers/probes Sequence (5′-3′) Modification
ARMS-PCR 16S rRNA HP-F CCCATCAGGAAACATCGCTTCA  
HP-R TCCACTATGCTGGAGAATTGGCTA  
HP-P-ROX TGCTTGCCACGCCATCCATCACATCA 5′ROX, 3′BHQ1
gyrA 259-F CACCCCCATGGCGGTT  
261G-F CCCCATGGCGATACG  
261A-F CCCCATGGCGATACA  
271A-F CATGGCGATAATGCGGTTTGTA  
271T-F CATGGCGATAATGCGGTTTGTT  
272G-F ACCCCCATGGCGATAATGCGGTTTATCG  
HP-F-R ACTCGCCTTAGTCATTC  
HP-F-P-HEX CGTTATCGCCATCAATAGAGCCAA 5′HEX, 3′BHQ2
23S rRNA 2142C-F TCCTACCCGCGGCAAGACTGC  
2142G-F TTCCTCCTACCCGCGGCAAGACAGG  
2143G-F CCTACCCGCGGCAAGACGACG  
HP-C-R GGATGACTCCATAAGAGCCAAAGC  
HP-C-P-FAM CGTCTTGCCGCGGGTAGGAGGAATTTTCAC 5′FAM, 3′BHQ1
Internal control ACTIN-F CCCATCTACGAGGGCTACGC  
ACTIN-R GGATCTTCATGAGGTAGTCGGTCAG  
ACTIN-P-CY5 CCATCCTGCGTCTGGACCTGGCTGGC 5′CY5, 3′BHQ2
Sanger sequencing 23S rRNA 23S-F TCCCTCCCGACTGTTTACCAAA  
23S-R GCCATTACACTCAACTTGCGATTTC  
gyrA gyrA-F GCAAGATAATTCAGTCAATGAAACA  
gyrA-R CCACAGCGATCCCATTAGC