Skip to main content

Table 7 Oligonucleotide primers and conditions used to amplify different virulence marker genes in E. faecalis strains by PCR

From: Genetic relatedness of the Enterococcus faecalis isolates in stool and urine samples of patients with community-acquired urinary tract infection

Gene Primer sequence (5′-3′) Annealing temperature Amplicon size (bp) References
ddlE.faecalis ATCAAGTACAGTTAGTCTTTATTAG
ACGATTCAAAGCTAACTGAATCAGT
49 941 [19]
Esp AGATTTCATCTTTGATTCTTGG
AATTGATTCTTAGCATCTGG
48 510 [19]
asa1 TAGGAGTTGTAGGATTAGCTAC
TGTTGTATTCMGCSACTTC
47 677 This study
Ace GGAATGACCGAGAACGATGGC
GCTTGATGTTGGCCTGCTTCCG
58 616 [12]
cyl ACTCGGGGATTGATAGGC
GCTGCTAAAGCTGCGCTT
52 688 [2]
gelE TATGACAATGCTTTTTGGGAT
AGATGCACCCGAAATAATATA
58 213 [2]
efbA GCACAAGTCCCAAAAGGAGC
AAGTGCGGCTTCAGTAAGGG
58 510 This study
  1. esp, Enterococcal surface protein; asa1, Aggregation substance; ace, Adhesion of collagen of enterococci; cyl, Cytolysin; gelE, Gelatinase; efbA, Pav A-like fibronectin-binding protein