Skip to main content

Table 1 PCR primers used in this study

From: Colistin-resistant Escherichia coli carrying mcr-1 in food, water, hand rinse, and healthy human gut in Bangladesh

Target genePrimerSequenceAmplicon size (bp)References
mcr1CLR5FCGGTCAGTCCGTTTGTTC309[10]
CLR5RCTTGGTCGGTCTGTA GGG
LTLT 450FGGCGACAGATTATACCGTGC450[21]
LT 450RCGGTCTCTATATTCCCTGT
STpSTp186FTCTGTATTATCTTTCCCCTC186[22]
STp 186RATAACATCCAGCACAGGC
SThSTh5fTCACCTTTCCCTCAGGAT160[23]
STh6rTACAAGCAGGATTACAACAC
pCVD432EAEC1CTGGCGAAAGACTGTATCAT630[24]
EAEC2CAATGTATAGAAATCCGCTGTT
blaCTX-M-15CTX-M-15FCACACGTGGAATTTAGGGACT996[25]
CTX-M-15RGCCGTCTAAGGCGATAAACA
blaCTX-M-2CTXM2FCGGYGCTTAAACAGAGCGAG891[26]
CTXM2RCCATGAATAAGCAGCTGATTGCCC
blaCTX-M-8CTXM8FACGCTCAACACCGCGATC490[26]
CTXM8RCGTGGGTTCTCGGGGATAA
blaCTX-M-9CTXM9FGATTGACCGTATTGGGAGTTT947[26]
CTXM9RCGGCTGGGTAAAATAGGTCA
blaTEMTEM-RACGCTCAGTGGAACGAAAAC1150[27]
TEM-FATTCTTGAAGACGAAAGGGC
blaNDM1NDM-1FGGTTTGGCGATCTGGTTTTC621[28]
NDM-1RCGGAATGGCTCATCACGATC
blaOXA-48OXA-FGCGTGGTTAAGGATGAACAC438[29]
OXA-RCATCAAGTTCAACCCAACCG
blaCMY-2CMY-2-RCCCGTTTTATGCACCCATGA870[30]
CMY-2-FTGGCCGTTGCCGTTATCTAC
mphAmphA-FGTGAGGAGGAGCTTCGCGAG403[31]
mphA-RTGCCGCAGGACTCGGAGGTC