Skip to main content

Table 1 Sequences and house-keeping genes

From: Adherent invasive Escherichia coli (AIEC) strain LF82, but not Candida albicans, plays a profibrogenic role in the intestine

Primers Source Forward sequence Reverse sequence
Col1a1 Mouse GAGTACTGGATCGACCCTAACCAA ACACAGGTCTGACCTGTCTCCAT
Col3a1 Mouse GCCCACAGCCTTCTACAC CCAGGGTCACCATTTCTC
Fn1 Mouse CGAAGCCGGGAAGAGCAAG CGTTCCCACTGCTGATTTATCTG
Vim Mouse CCGTTCAAGGTCAAGACGTGCC AGGAGGCCGAAAGCACCCTGC
Il1b Mouse AGCTCTCCACCTCAATGGAC AGGCCACAGGTATTTTGTCG
Il6 Mouse TACACATGTTCTCTGGGAAATCGT AAGTGCATCATCGTTGTTCATACA
Il12b Mouse GGAAGCACGGCAGCAGAAT GGCGGGTCTGGTTTGATG
Il17a Mouse GCAAGAGATCCTGGTCCTGA AGCATCTTCTCGACCCTGAA
Ifng Mouse CAGCAACAGCAAGGCGAAA CTGGACCTGTGGGTTGTTGAC
Ccl4 Mouse CCACTTCCTGCTGTTTCTCT TTGGTCAGGAATACCACAGC
Adgre1 Mouse CTTTGGCTATGGGCTTCCAGTC GCAAGGAGGACAGAGTTTATCGTG
Ly6g Mouse TGGACTCTCACAGAAGCAAAG GCAGAGGTCTTCCTTCCAACA
Cd3e Mouse ATGCGGTGGAACACTTTCTGG GCACGTCAACTCTACACTGGT
Tbx21 Mouse TTCCCATTCCTGTCCTTCAC CCACATCCACAAACATCCTG
Gata3 Mouse GGAAACTCCGTCAGGGCTA AGAGATCCGTGCAGCAGAG
Rorc Mouse GAAAGCAGGAGCAATGGAAG GATGGAAAGCCAGTTCCAAA
Polr2a Mouse GGTGCTGTGGGTACGGATACA CCCACAACCAGCTATCCTCAA
FN1 Human GATGCTCCCACTAACCTCCA CGGTCAGTCGGTATCCTGTT
VIM Human GCAGGCTCAGATTCAGGAACA GTGAGGTCAGGCTTGGAAACA
OCLN Human AGGACGTGCCTTCACCCCCA ACCACCGCTGCTGTAACGAGG
IL1B Human GATGCACCTGTACGATCACT GACATGGAGAACACCACTTG
IL6 Human AGTGAGGAACAAGCCAGAGC GTCAGGGGTGGTTATTGCAT
IL12B Human CCTGACCATCCAAGTCAAAGAGT AGGAGCGAATGGCTTAGAACCT
IL8 Human AAATCAGGAAGGCTGCCAAGA AAGGAACCATCTCACTGTGTGTAAAC
GAPDH Human GACACCCACTCCTCCACCTTT TTGCTGTAGCCAAATTCGTTGT