Skip to main content

Table 1 Primers used in this study and their annealing temperature

From: Prevalence, antimicrobial resistance, and genotyping of Shiga toxin-producing Escherichia coli in foods of cattle origin, diarrheic cattle, and diarrheic humans in Egypt

Category Target gene Primers sequences (5′–3′) PCR type Amplified segment (bp) Annealing temperature (˚C)
Stx stx1 F: ACACTGGATGATCTCAGTGG Duplex 614 60
R: CTGAATCCCCCTCCATTATG
stx2 F: CCATGACAACGGACAGCAGTT 779
R: CCTGTCAACTGAGCAGCACTTTG
MBLs blaIMP F: CATGGTTTGGTGGTTCTTGT Uniplex 488 55
R: ATAATTTGGCGGACTTTGGC
blaVIM F: AGTGGTGAGTATCCGACAG 261 52
R: ATGAAAGTGCGTGGAGAC
blaNDM-1 F: GGCGGAATGGCTCATCACGA 287 58
R: CGCAACACAGCCTGACTTTC
ESBLs blaOXA-1 group F: GGCACCAGATTCAACTTTCAAG Multiplex 564 61
R: GACCCCAAGTTTCCTGTAAGTG
blaTEM group F: CATTTCCGTGTCGCCCTTATTC 800
R: CGTTCATCCATAGTTGCCTGAC
blaCTX-M-1 group F: TTAGGAAGTGTGCCGCTGTA 655
R: CGGTTTTATCCCCCACAAC
  1. Stx: Shiga like toxin producing genes; MBLs: metallo-β-lactamase (carbapenemase)-producing genes; ESBLs: extended-spectrum β-lactamase producing genes