Skip to main content

Table 1 Sequences of primers used in this study

From: Association of LRRK2 rs11564258 single nucleotide polymorphisms with type and extent of gastrointestinal mycobiome in ulcerative colitis: a case–control study

Target Primer (5ʹ to 3ʹ) Amplicon sizes (bp) TM (°C)
LRRK2( DNA)
(SNP Rs11564258)
F:ACCAAGGATACCCTAACTTCTTACCAA
R: TCGATGGTGTTCTCAGCCCA
330 62
LRRK2 (mRNA) F:GGGTGCGAAGAGGACGAGGA
R: AACCCACCTGCTGCACTC
223 62
Dectin-1 F:GATTTAGAAAATTTGGATGAAGATGG
R:TATCACCAGTATTACCAAGCATA
165 59
GAPDH F: ATGCCTCCTGCACCACCAAC
R: TGACCTTGCCCACAGCCTTG
216 60