Skip to main content

Table 1 Primer sequences for qRT-PCR analyses

From: Interaction between PSMD10 and GRP78 accelerates endoplasmic reticulum stress-mediated hepatic apoptosis induced by homocysteine

Gene GenBank Primer sequence, 5′ to 3′
GAPDH NM_002814.4 F: GGTGAAGGTCGGTGTGAACG
R: CTCGCTCCTGGAAGATGGTG
PSMD10 NM_001256799.3 F: GAACTGACCAGGACAGCAGAACTG
R: AGCAGAAGCCGCAATATGAAGAGG
U6   GCTTCGGCAGCACATATACTAAAAT
miR-212-5p   ACCTTGGCTCTAGACTGCTTACTG
GRP78 NM_001163434.1 F:ATGATGAAGTTCACTGTGGTGG
R:CTGATCGTTGGCTATGATCTCC
Si-PSMD10   F:CCAGAUGCUAAGGACCAUUTT
R:AAUGGUCCUUAGCAUCUGGTT
Si-GRP78   F:GGCCACUAAUGGAGAUACUTT
R:AGUAUCUCCAUUAGUGGCCTT