Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer sequences, annealing temperatures and PCR product sizes for the putative virulence factors studied

From: Campylobacter jejuni isolates in Finnish patients differ according to the origin of infection

Gene Primers Sequence (5'-3') Annealing temp (°C) Product (bp) Reference
gly A Gly-Fw
Gly-rev
GAGTTAGAGCGTCAATGTGAAGG
AAACCTCTGGCAGTAAGGGC
53-51 1052 [36]
virB11 VirB-232
VirB-701
TCTTGTGAGTTGCCTTACCCCTTTT
CCTGCGTGTCCTGTGTTATTTACCC
53 494 [35]
ceu E CeuE405F
CeuE405R
GATAAAGTCGTTGGCGTTCC
GCGAGATTGGAGGACCAAAGG
60 405 *
cia B ciaB355F
ciaB355R
CAGAAGGAGAAATTTGTGAGC
ATATCCCATTCTAATGCCACC
58 355 *
pld A pldA-84fwd
pld-981rev
AAGCTTATGCGTTTTT
TATAAGGCTTTCTCCA
45 913 [35]
Cj0486 Cj0486fwd
Cj0486rev
GATAGAGCATTAAATTGGGATG
CCTATAAAGCCATACCAAGCC
58 1263 [13]
wla N wlaN-DL 39
Cj1139cF
TTAAGAGCAAGATATGAAGGTG
TGCTGGGTATACAAAGGTTGTG
60 434 [17, 37]
cgt B wlaN-DL 39
cgtBrev
TTAAGAGCAAGATATGAAGGTG
GCACATAGAGAACGCTACAA
56 563 [17]
cdtABC LYA-F
MII-R
CTTTATGCATGTTCTTCTAAATTT
GTTAAAGGTGGGGTTATAATCATT
55 2111 [38]
  1. *Personal communication: Rafal Gierczyński, National Institute of Public Health, Warsaw, Poland.