Skip to main content

Table 3 List of primers used in this study

From: Use of REP- and ERIC-PCR to reveal genetic heterogeneity of Vibrio cholerae from edible ice in Jakarta, Indonesia

No Primer Sequence References
1 ERIC1R (5'ATGTAAGCTCCTGGGGATTCAC 3') [19]
2 ERIC2 (5'AAGTAAGTGACTGGGGTGAGCG 3')  
3 REP 1R (5'-IIIICGICGICATCIGGC-3') [18]
4 REP 2I (5'-ICGICTTATCIGGCCTAC-3')