Skip to main content

Table 4 Primers for VAGs of E. coli

From: Adhesion patterns of commensal and pathogenic Escherichia coli from humans and wild animals on human and porcine epithelial cell lines

Genes Primer and probe sequences Fragment length Accession Source of primer
   (5′ 3 f: forward; r: reverse)    
Multiplex PCR
ipa H f GTTCCTTGACCGCCTTTCCGATACCGTC 619 M32063 [17]
r GCCGGTCAGCCACCCTCTGAGAGTAC
daa D f TGAACGGGAGTATAAGGAAGATG 371 AY525531.1 [17]
r GTCCGCCATCACATCAAAA
elt B f TCTCTATGTGCATACGGAGC 322 EU113252.1 [17]
r CCATACTGATTGCCGCAAT
eae A f CCTGGTTACAACATTATGGAACG 287 AJ308550.1 [4]
r TGAAATAGTCTCGCCAGTATTCG
stx 2 f GGCACTGTCTGAAACTGCTCC 255 FN252459 [17]
r TCGCCAGTTATCTGACATTCTG
agg R f CGTAAGCCGGGTATGAAAGA 188 Z32523.1 [4]
r GCCAGTTCAGAAGCAGGAAC
est 1a f TTTCCCCTCTTTTAGTCAGTCAA 159 M25607.1 AY342057.1 [17]
r GCAGGATTACAACACAATTCACAGCAG
stx 1 f CTGGATTTAATGTCGCATAGTG 150 HM367099.1 [17]
r AGAACGCCCACTGAGATCATC
est 2 f CTATTGCTACAAATGCCTATGC 126 M35586.1 [4]
r CTCCAGCAGTACCATCTCTA [18]
Single PCR
pEAF f CAGGGTAAAAGAAAGATGATAA 397 X76137.1 [16]
  r TATGGGGACCATGTATTATCA