Skip to main content

Table 1 Oligonucleotide primers used for the amplification of the intergenic and adjacent o454-nlpD genomic region of E. coli

From: Correlation between the genomic o454-nlpD region polymorphisms, virulence gene equipment and phylogenetic group of extraintestinal Escherichia coli (ExPEC) enables pathotyping irrespective of host, disease and source of isolation

Primer name Genetic regiona Predicted amplicon size (bp) in reference strainsb Forward/reverse primer sequences (5?-3?)
For Rev   MG1655 CFT073 E2348/69 EDL933  
F1 R1 fhlA-mutS 1.208 1.673 1.208 1.208 AGAGTTCCGTAGCGATCTC/CTGCTGCATCATGGGCGTAT
F1 R2 fhlA-nlpD 11.840 14.357 15.192 8.679 AGAGTTCCGTAGCGATCTC/ CATAACGACACAATGCTGGTCC
F2 R1 ygbA-mutS 361 360 359 361 TTCACGAGAGATACGCTTGC/CTGCTGCATCATGGGCGTAT
F3 R3 mutS-o388 2.881 2.881 2.881 - AAAGCATTTCGCCGAACGCCGC/CATCGGCGATAACGCCAAT
F3 R4 mutS-yclC - - 7.365 1.318 AAAGCATTTCGCCGAACGCCGC/GACAACCGTGGTCACTACA
F4 R3 f265-o388 1.146 1.146 1.146 - ACGCTCTACGGGTATCAACT/CATCGGCGATAACGCCAAT
F5 R2 o454-nlpD 1.318 3.685 4.546 - AAGCCCTTGCCAACATGCTAC/CATAACGACACAATGCTGGTCC
F5 R5 o454-o347 - 816 - - AAGCCCTTGCCAACATGCTAC/CGTCAGGTTGAAATGCTTGACT
F5 R4 o454-yclC - - 716 - AAGCCCTTGCCAACATGCTAC/GACAACCGTGGTCACTACA
F6 R2 slyA-nlpD - - 1.394 1.393 TTGAGTGCAGAAGAGCAGG/CATAACGACACAATGCTGGTCC
F2 R1 c3292-mutS - 1.120 1.119 - TAACCGGAACAGTTAGCGC/CTGCTGCATCATGGGCGTAT
  1. aBiological functions of amplified genes: fhlA, formate hydgrogen lyase; mutS, mismatch repair protein; nlpD, outer membrane lipoprotein; ygbA, hypothetical protein; o388 (syn. ygbK), hypothetical protein; yclC (syn. kpdC), 4-hydroxybenzoate decarboxylase determinant; f265 (syn. ygbL), hypothetical transcriptional regulator; o454 (syn. b2740 and ygbN), putative zinc-dependent hydrolase; o347 (syn. c3302), limited level of similarity to enzymes implicated in antibiotic hydrolysis and synthesis; slyA (syn. kpdR), 4-hydroxybenzoate decarboxylase determinant, in Salmonella transcriptional regulator, required for survival within macrophages the induction of hemolytic and pore-forming proteins; c3292, putative molybdenum-pterin-binding protein. bBased on whole genome sequences deposited to GenBank under accession numbers U00096 (MG1655), NC_004431 (CFT073), FM180568 (E2348/69), and NC_0022655 (EDL933).