Skip to main content

Table 2 The attachment sites of zot-containing Campylobacter prophages

From: Zonula occludens toxins and their prophages in Campylobacter species

Prophage Starta Enda Attachment gene sequenceb tRNA (locus_tag)
CON_phi1, CON_phi2 and CON_phi3
(C. concisus 13826)c
1582286 1582311 TTCAAATCCCTCTCTGTCCGCCACCA tRNA-Ser (CCC13826_RS07905)
1587508 1587533 TTCAAATCCCTCTCTGTCCGCCACCA  
1597113 1597138 TTCAAATCCCTCTCTGTCCGCCACCA  
1606718 1606743 TTCAAATCCCTCTCTGTCCGCCACCA  
1616160 1616185 TTCAAATCCCTCTCTGTCCGCCACCA  
CON_phi4
(C. concisus 13826)
946941 946993 CTCATAACCCGAAGGTCGGCGGTTCAA
ATCCGTCCTCCGCAACCAAATACCGA
tRNA-Met (CCC13826_RS04780)
937290 937342 CTCATAACCCGAAGGTCGGCGGTTCAA
ATCCGTCCTCCGCAACCAAATACCGA
 
URE_phiZA
(C. ureolyticus
DSM 20703)
68067 68122 ATAACCCGAAGGTCGGAGGTTCAAGTCCT
TCCTCTGCAACCAAATCACCATTTTAC
tRNA-Met (C512_RS0103965)
57811 57866 ATAACCCGAAGGTCGGAGGTTCAAGTCCT
TCCTCTGCAACCAAATCACCATTTTAC
 
URE_phiZB
(C. ureolyticus
DSM 20703)
139564 139610 GTTCAAGTCTCGCTGATCGCACCATTA
AAGAAAAAATTAAGAATACT
tRNA-Leu (C512_RS0100765)
130103 130149 GTTCAAGTCTCGCTGATCGCACCATTA
AAGAAAAAATTAAGAATACT
 
COR_phiZA
(C. corcagiensis
CIT045)
254051 254088 CGAAGGTCAGGGGTTCAAGTCCCTTCT
CTGCAACCAAA
tRNA-Met
(SA94_RS06290)
265302 265339 CGAAGGTCAGGGGTTCAAGTCCCTTCT
CTGCAACCAAA
 
COR_phiZB
(C. corcagiensis
CIT045)
257240 257264 GTTCAAATCCCTCTCTGTCCGCCAC tRNA-Ser
(SA94_RS04510)
247319 247343 GTTCAAATCCCTCTCTGTCCGCCAC  
GRACI_phiZ
(C. gracilis
RM3268)
112826 112871 CTCATAACCCGAAGGTCGGTGGTTCAA
ATCCACCCTCTGCAACCAA
tRNA-Met (CAMGR0001_2931)
102518 102563 CTCATAACCCGAAGGTCGGTGGTTCAA
ATCCACCCTCTGCAACCAA
 
DOYLEI_phiZ
(C. jejuni subsp. doylei 269.97)
303215 303241 AGGGTTCAAATCCCTCTCTGTCCGCCA tRNA-Ser (JJD26997_RS01570)
313165 313191 AGGGTTCAAATCCCTCTCTGTCCGCCA  
HYO_phiZ
(C. hyointestinalis subsp. hyointestinalis
DSM 19053)
360409 360446 CTCATAACCCGAAGGTCGGAGGTTCAA
GTCCTTCTCTC
tRNA-Met
(CR67_RS01810)
369716 369753 CTCATAACCCGAAGGTCGGAGGTTCAA
GTCCTTCTCTC
 
HYO_phiZ
(C. hyointestinalis subsp. lawsonii
CCUG 27631)
1283134 1283238 CTCATAACCCGAAGGTCGGAGGTTCAAGT
CCTTCTCTCGCAACCAAATAAGCATAAAA
TCATCTTTTAAAGCACATTGTTTTAAAGCT
TAAAATAATCTTACTTT
tRNA-Met
(CHL_RS06785)
1273720 1273824 CTCATAACCCGAAGGTCGGAGGTTCAAGT
CCTTCTCTCGCAACCAAATAAGCATAAAA
TCATCTTTTAAAGCACATTGTTTTAAAGCT
TAAAATAATCTTACTTT
 
  1. aThe start and end positions for the attachment sites refer to the nucleotide position within the contig containing the prophage genomes, except for C. concisus strains 13826, C. jejuni subsp. doylei 269.97 and C. hyointestinalis subsp. lawsonii CCUG 27631 which refer to the nucleotide position in the full genome
  2. bAttachment sites overlapped with 3′ end of tRNA, the overlapped sequences were italic
  3. cMultiple insertion sites for CON_phi prophages in C. concisus 13826 in which only the first attachment site (for CON_phi1) overlapped with tRNA. In NCBI database, the contig encoding JEJUNI_phiZ did not cover the full prophage genome; therefore it was unable to locate the attachment sites. No attachment site was identified in IGUA_phiZ