Skip to main content

Table 1 Primers used for PCR in this study

From: Effect of antibiotic pre-treatment and pathogen challenge on the intestinal microbiota in mice

Target Primer designation Primer sequencea
Total bacteria
16S rRNA
519F GGACTACCVGGTATCTAAKCC
785R CAGCAGCCGCGGTRATA
C. jejuni
luxS
F AGCGATCAAAGCAAAATTCC
R GGCAATTTGTTTGGCTTCAT
A. baumannii
Oxa-51
F TTTAGCTCGTCGTATTGGACTTGA
R GCCTCTTGCTGAGGAGTAATTTTT
  1. aV = A + C + G, K = G + T, R = A + G