Skip to main content

Table 1 Mouse oligonucleotide sequences

From: Role of TLR1, TLR2 and TLR6 in the modulation of intestinal inflammation and Candida albicans elimination

Primers Sequence (5′–3′)
POLR2A S
POLR2A AS
CCCACAACCAGCTATCCTCAA
GGTGCTGTGGGTACGGATACA
IL-1β S
IL-1β AS
AGCTCTCCACCTCAATGGAC
AGGCCACAGGTATTTTGTCG
TNF-α S
TNF-α AS
CCACCACGCTCTTCTGTCTA
GAGGCCATTTGGGAACTTCT
IL-17A S
IL-17A AS
GCAAGAGATCCTGGTCCTGA
AGCATCTTCTCGACCCTGAA
IL-10 S
IL-10 AS
CAGTACAGCCGGGAAGACAATAA
CCGCAGCTCTAGGAGCATGT
  1. S sense, AS antisense