Molecular detection of human enteric viruses circulating among children with acute gastroenteritis in Valencia, Venezuela, before rotavirus vaccine implementation

Alcalá, Ana C.; Pérez, Kriss; Blanco, Ruth; González, Rosabel; Ludert, Juan E.; Liprandi, Ferdinando; Vizzi, Esmeralda

doi:10.1186/s13099-018-0232-2

Gut Pathogens

Table 1 Oligonucleotide primers and amplification conditions used in this study for the molecular detection of gastroenteritis viruses

From: Molecular detection of human enteric viruses circulating among children with acute gastroenteritis in Valencia, Venezuela, before rotavirus vaccine implementation

Virus	Target region	Rounds of PCR	Sense	Primer name	Sequence 5′–3′	Cycling protocol¹	Nucleotide position	Amplicon size (bp)	Reference
Calicivirus	RNA-dependent RNA polymerase	1st	−	289H	TGACGATTTCATCATCACCATA		4865–4886^a		34
	RNA-dependent RNA polymerase		−	289I	TGACGATTTCATCATCCCCGTA	A	4865–4886^a	319
			+	290YM	GATTACTCCAGGTGGGAYTCMAC		4568–4590^a		In this study
Adenovirus	Hexon	1st	+	hexAA1885	GCCGCAGTGGTCTTACATGCACATC	B	18,858–18,883^b	301	35
			−	hexAA1913	CAGCACGCCGCGGATGTCAAAGT	B	19,136–19,158
Astrovirus	ORF-1	1st	+	MON340	CGTCATTATTTGTTGTCATACT	C	1182–1203	289	36
			−	MON348	ACATGTGCTGCTGTTACTATG	C	1450–1470
		2nd	+	MON394d	GARATCCGTGATGCTAATGG	D	1250–1269	220	In this study
			−	MON348	ACATGTGCTGCTGTTACTATG	D	1450–1470		37
Aichi virus	3C-3D	1st	+	6261	ACACTCCCACCTCCCGCCAGTA	E	6261–6282^c	519	38
			−	6779	GGAAGAGCTGGGTGTCAAGA		6760–6779
Klassevirus	2C	1st	+	LG0098	CGTCAGGGTGTTCGTGATTA	F	4463–4482	345	27
			−	LG0093	AGAGAGAGCTGTGGAGTAATTAGTA		4783–4807
Enterovirus	5′NTR²	1st	+	EV1	CGGCCCCTGAATGCGGC	G	454–470	194	39
			−	EV2	CACCGGATGGCCAATCCA		630–647
Picobirnavirus			+	PicoB25	TGGTGTGGATGTTTC		665–679^d	201
Picobirnavirus	RNA-dependent RNA polymerase	Multiplex PCR	−	PicoB43	ARTGYT GGTCGAACTT	H	850–865^d		40
	RNA-dependent RNA polymerase	Multiplex PCR	+	PicoB23	CGGTATGGATGTTTC	H	685–699^e	369	40
			−	PicoB24	AAGCGAGCCCATGTA		1039–1053^e

¹Cycling conditions for the PCRs were as follows: A = 94 °C for 2 min, 40 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min, and a final elongation at 72 °C for 10 min; B = 94 °C for 4 min, 40 cycles of 92 °C for 1.5 min, 55 °C for 1.5 min, 72 °C for 2 min, and final elongation at 72 °C for 10 min; C = 94 °C for 5 min, 40 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s; and final elongation at 72 °C for 10 min; D = 94 °C for 2 min, 30 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 30 s, and final elongation at 72 °C for 10 min; E = 95 °C for 1 min, 40 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min and a final elongation at 72 °C for 10 min; F = 94 °C for 2 min, 40 cycles of 94 °C for 30 s, 56^◦C for 30 s, 72 °C for 1 min, and final elongation at 72 °C for 10 min; G = 94 °C for 2 min, 40 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min, and a final elongation at 72 °C for 7 min. H = 94 °C for 3 min, 40 cycles of 94 °C for 1 min, 42 °C for 1 min, 72 °C for 1 min, and a final elongation at 72 °C for 10 min
²5′nontranslated region
^aNumbering given according to positions in Norovirus GI, complete genome (NC_001959.2)
^bSequence position refers to the Ad2 hexon region. The primers used allow detecting the 47 human adenovirus serotypes
^cSequence position refers to Aichi virus genomic RNA, Ac. N. AB010145.1
^dSequence position refers to the 1-CHN-97 strain (Genogroup I)
^eSequence position refers to the 4-GA-91 strain (Genogroup II)

Back to article page

ISSN: 1757-4749

Contact us

Submission enquiries: journalsubmissions@springernature.com