Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Transcriptional regulation of the virulence genes and the biofilm formation associated operons in Vibrio parahaemolyticus

Target Primers (forward/reverse, 5′-3′)
Construction of mutants
 qsvR GTGACTGCAGATGCTAAAAGCGGTGATTC/GATTCAAATGCGATTTCTGTTGGCTGGTGGACGACTAATG
CATTAGTCGTCCACCAGCCAACAGAAATCGCATTTGAATC/GTGAGCATGCGAGAAGTCTGTAAACGAAACG
GTGACTGCAGATGCTAAAAGCGGTGATTC/GTGAGCATGCGAGAAGTCTGTAAACGAAACG
 toxR GTGACTGCAGAAACGCAATTTGTCTGATG/ATCTTCATGCTGGCCTCCTTTAGTTCTTCTTAGATGGATGATG
CATCATCCATCTAAGAAGAACTAAAGGAGGCCAGCATGAAGAT/GTGAGCATGCAATTCGGCGGCTTTGTTC
GTGACTGCAGAAACGCAATTTGTCTGATG/GTGAGCATGCAATTCGGCGGCTTTGTTC
Protein expression
 qsvR AGCGGGATCCATGCCGAACATTGAGATCATTC/AGCGAAGCTTTTAACCTCTTACTACCTGATTACG
qPCR
 toxR TTGTTTGGCGTGAGCAAGG/TAGCAGAGGCGTCATTGTTATC
 calR ATGTAAAAAGAAAACCGTACA/AACACAGCAGAATGACCGTG
 cpsQ GCCTGAAATCCTAATGCTC/AGTGTCAGAAGGTGTATCAAC
 mfpA GCGGGCAATGATCGTCTAAC/TCACCTGAACCTGCGACAAG
Primer extension
 toxR /TTAGTTCTTCTTAGATGGATGATG
 calR /GCAAAATATCGGTACTTCA
 cpsQ /GATTTCAGGCTTTTCCGTGTAC
 mfpA /ATTCCCTCTGGCTTATTTATTG
LacZ fusion
 toxR GCGCGTCGACATCGTTAAGGTATTTGCA/GCGCGAATTCCGAGCGAATTACTATTTGG
 calR GCGGTCGACGTTTGTTTGCTCGGATTGTTTG/GCGTCTAGACAAAGTGCTTTCCATACGGTAG
 cpsQ GCGCGTCGACCAGACGGGCATTGATAAG/GCGCGAATTCCATTAGGATTTCAGGCTTTT
 mfpA GCGCGTCGACTTATGACTTAGATACCGAA/GCGCGAATTCCGAAATCAGCGATATTGTTG
EMSA
 toxR ATCGTTAAGGTATTTGCA/CGAGCGAATTACTATTTGG
 calR GTTTGTTTGCTCGGATTGTTTG/CAAAGTGCTTTCCATACGGTAG
 cpsQ GTTCCAGCAATACTGACTAAGC/GATTTCAGGCTTTTCCGTGTAC
 mfpA TAGGACGCAAGCCACAAG/CGAAATCAGCGATATTGTTG
DNase I footprinting
 toxR TTTCAGGGACGACTTTGTG/TTAGTTCTTCTTAGATGGATGATG
 calR ATTCCCTCTGGCTTATTTATTG/CCACGGCATTACTTACTG
 cpsQ TACCTAACTAATTTAGTGCA/GATTTCAGGCTTTTCCGTGTAC
 mfpA ACATACTATTAAATCGCATC/ATTCCCTCTGGCTTATTTATTG