Skip to content

Advertisement

Open Access

Correction to: CRISPR-like sequences in Helicobacter pylori and application in genotyping

  • Khotchawan Bangpanwimon1,
  • Jaksin Sottisuporn2,
  • Pimonsri Mittraparp-arthorn1,
  • Warattaya Ueaphatthanaphanich3,
  • Attapon Rattanasupar4,
  • Christine Pourcel5 and
  • Varaporn Vuddhakul1Email author
Gut Pathogens20179:72

https://doi.org/10.1186/s13099-017-0221-x

Received: 18 November 2017

Accepted: 27 November 2017

Published: 11 December 2017

The original article was published in Gut Pathogens 2017 9:65

Correction to: Gut Pathog (2017) 9:65 https://doi.org/10.1186/s13099-017-0215-8

In the original version of this article [1], published on 17 November 2017, Table 2 contains an error: the first “T” in the first sequence in the column ‘Consensus direct repeats (CDRs) sequences’ has been incorrectly underlined. In Table 2, the underlining indicates the Consensus sequence.
  • The sequence was originally underlined like this:

    AACAGCACTTTCAATCAAGGGACTTACAA

  • The sequence should have been underlined like this:

    AACAGCACTTTCAATCAAGGGACTTACAA

The original publication of this article has been corrected.

Notes

Declarations

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Microbiology, Faculty of Science, Prince of Songkla University, Hat Yai, Thailand
(2)
NKC Institute of Gastroenterology and Hepatology, Songklanagarind Hospital, Faculty of Medicine, Prince of Songkla University, Hat Yai, Thailand
(3)
Microbiology Laboratory, Vichaiyut Hospital, Bangkok, Thailand
(4)
KC Center of Gastroenterology and Hepatology, Hat Yai Hospital, Hat Yai, Thailand
(5)
Institute for Integrative Biology of the Cell (I2BC), CEA, CNRS, Univ. Paris-Sud, Université Paris-Saclay, Gif-sur-Yvette, France

Reference

  1. Bangpanwimon K, Sottisuporn J, Mittraparp-arthorn P, Ueaphatthanaphanich W, Rattanasupar A, Pourcel C, Vuddhakul V. CRISPR-like sequences in Helicobacter pylori and application in genotyping. Gut Pathog. 2017;9:65. https://doi.org/10.1186/s13099-017-0215-8.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© The Author(s) 2017

Advertisement