Skip to main content
Download PDF

Correction to: CRISPR-like sequences in Helicobacter pylori and application in genotyping

Gut Pathogens volume 9, Article number: 72 (2017) Cite this article

The Original Article was published on 17 November 2017

Correction to: Gut Pathog (2017) 9:65 https://doi.org/10.1186/s13099-017-0215-8

In the original version of this article [1], published on 17 November 2017, Table 2 contains an error: the first “T” in the first sequence in the column ‘Consensus direct repeats (CDRs) sequences’ has been incorrectly underlined. In Table 2, the underlining indicates the Consensus sequence.

  • The sequence was originally underlined like this:

    AACAGCACTTTCAATCAAGGGACTTACAA

  • The sequence should have been underlined like this:

    AACAGCACTTTCAATCAAGGGACTTACAA

The original publication of this article has been corrected.

Reference

  1. Bangpanwimon K, Sottisuporn J, Mittraparp-arthorn P, Ueaphatthanaphanich W, Rattanasupar A, Pourcel C, Vuddhakul V. CRISPR-like sequences in Helicobacter pylori and application in genotyping. Gut Pathog. 2017;9:65. https://doi.org/10.1186/s13099-017-0215-8.

    Article  PubMed  PubMed Central  Google Scholar 

Download references

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Author information

Authors and Affiliations

  1. Department of Microbiology, Faculty of Science, Prince of Songkla University, Hat Yai, Thailand

    Khotchawan Bangpanwimon, Pimonsri Mittraparp-arthorn & Varaporn Vuddhakul

  2. NKC Institute of Gastroenterology and Hepatology, Songklanagarind Hospital, Faculty of Medicine, Prince of Songkla University, Hat Yai, Thailand

    Jaksin Sottisuporn

  3. Microbiology Laboratory, Vichaiyut Hospital, Bangkok, Thailand

    Warattaya Ueaphatthanaphanich

  4. KC Center of Gastroenterology and Hepatology, Hat Yai Hospital, Hat Yai, Thailand

    Attapon Rattanasupar

  5. Institute for Integrative Biology of the Cell (I2BC), CEA, CNRS, Univ. Paris-Sud, Université Paris-Saclay, Gif-sur-Yvette, France

    Christine Pourcel

Authors
  1. Khotchawan Bangpanwimon
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Jaksin Sottisuporn
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Pimonsri Mittraparp-arthorn
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Warattaya Ueaphatthanaphanich
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Attapon Rattanasupar
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Christine Pourcel
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Varaporn Vuddhakul
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Varaporn Vuddhakul.

Additional information

The original article can be found online at https://doi.org/10.1186/s13099-017-0215-8.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Bangpanwimon, K., Sottisuporn, J., Mittraparp-arthorn, P. et al. Correction to: CRISPR-like sequences in Helicobacter pylori and application in genotyping. Gut Pathog 9, 72 (2017). https://doi.org/10.1186/s13099-017-0221-x

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13099-017-0221-x

Gut Pathogens

ISSN: 1757-4749