Skip to main content

Advertisement

Correction to: CRISPR-like sequences in Helicobacter pylori and application in genotyping

Article metrics

The original article was published in Gut Pathogens 2017 9:65

Correction to: Gut Pathog (2017) 9:65 https://doi.org/10.1186/s13099-017-0215-8

In the original version of this article [1], published on 17 November 2017, Table 2 contains an error: the first “T” in the first sequence in the column ‘Consensus direct repeats (CDRs) sequences’ has been incorrectly underlined. In Table 2, the underlining indicates the Consensus sequence.

  • The sequence was originally underlined like this:

    AACAGCACTTTCAATCAAGGGACTTACAA

  • The sequence should have been underlined like this:

    AACAGCACTTTCAATCAAGGGACTTACAA

The original publication of this article has been corrected.

Reference

  1. 1.

    Bangpanwimon K, Sottisuporn J, Mittraparp-arthorn P, Ueaphatthanaphanich W, Rattanasupar A, Pourcel C, Vuddhakul V. CRISPR-like sequences in Helicobacter pylori and application in genotyping. Gut Pathog. 2017;9:65. https://doi.org/10.1186/s13099-017-0215-8.

Download references

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Author information

Correspondence to Varaporn Vuddhakul.

Additional information

The original article can be found online at https://doi.org/10.1186/s13099-017-0215-8.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Bangpanwimon, K., Sottisuporn, J., Mittraparp-arthorn, P. et al. Correction to: CRISPR-like sequences in Helicobacter pylori and application in genotyping. Gut Pathog 9, 72 (2017) doi:10.1186/s13099-017-0221-x

Download citation